Orthologous regulated operons containing VV20839 gene
| Regulog: | Fur - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio vulnificus CMCP6 | ||||
|
Position: -133
Score: 5.53886 Sequence: TAATGATATACATTCTCATTT
Locus tag: VV20839
Name: VV20839 Funciton: Isochorismate pyruvate-lyase of siderophore biosynthesis # Vulnibactin-specific
Locus tag: VV20838
Name: VC0771 Funciton: Isochorismatase (EC 3.3.2.1) of siderophore biosynthesis # Vibriobactin-specific, VibB
Locus tag: VV20837
Name: viuB Funciton: Vibriobactin utilization protein ViuB |
||||
| VV20839-VC0771-viuB | -133 | 5.5 | TAATGATATACATTCTCATTT | VV20839 |