Orthologous regulated operons containing bfd gene
| Regulog: | Fur - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Photobacterium profundum SS9 | ||||
|
Position: -59
Score: 5.09296 Sequence: AAATGCAAACGATTCTCGTTT
Locus tag: PBPRA0317
Name: bfd Funciton: Bacterioferritin-associated ferredoxin
Locus tag: PBPRA0318
Name: bfr Funciton: Bacterioferritin |
||||
| bfd-bfr | -59 | 5.1 | AAATGCAAACGATTCTCGTTT | PBPRA0317 |
| Vibrio cholerae O1 biovar eltor str. N16961 | ||||
|
Position: -54
Score: 4.88758 Sequence: AAATAAGAGTGATTCTCTTTT
Locus tag: VC0364
Name: bfd Funciton: Bacterioferritin-associated ferredoxin
Locus tag: VC0365
Name: bfr Funciton: Bacterioferritin |
||||
| bfd-bfr | -54 | 4.9 | AAATAAGAGTGATTCTCTTTT | VC0364 |
| Vibrio harveyi ATCC BAA-1116 | ||||
|
Position: -58
Score: 4.53494 Sequence: TAACAAGAACGATTCTTGTTT
Locus tag: VIBHAR_00053
Name: bfd Funciton: Bacterioferritin-associated ferredoxin
Locus tag: VIBHAR_00052
Name: bfr Funciton: Bacterioferritin |
||||
| bfd-bfr | -58 | 4.5 | TAACAAGAACGATTCTTGTTT | VIBHAR_00053 |
| Vibrio parahaemolyticus RIMD 2210633 | ||||
|
Position: -59
Score: 4.36142 Sequence: TAACAAGAACCATTCCCGTTT
Locus tag: VP2769
Name: bfd Funciton: Bacterioferritin-associated ferredoxin
Locus tag: VP2768
Name: bfr Funciton: Bacterioferritin |
||||
| bfd-bfr | -59 | 4.4 | TAACAAGAACCATTCCCGTTT | VP2769 |
| Vibrio vulnificus CMCP6 | ||||
|
Position: -57
Score: 5.53794 Sequence: TAATGATAATGATTATCTATT
Locus tag: VV1_1340
Name: bfd Funciton: Bacterioferritin-associated ferredoxin
Locus tag: VV1_1341
Name: bfr Funciton: Bacterioferritin |
||||
| bfd-bfr | -57 | 5.5 | TAATGATAATGATTATCTATT | VV1_1340 |