Orthologous regulated operons containing torS gene
| Regulog: | Fur - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio cholerae O1 biovar eltor str. N16961 | ||||
|
Position: -41
Score: 5.35212 Sequence: TAACGATAATTATTCTTAATA
Locus tag: VCA0068
Name: torS Funciton: Methyl-accepting chemotaxis protein |
||||
| torS | -41 | 5.4 | TAACGATAATTATTCTTAATA | VCA0068 |
| Vibrio harveyi ATCC BAA-1116 | ||||
|
Position: -2
Score: 5.33438 Sequence: AAATGATAATAGTTATAATCT
Locus tag: VIBHAR_05136
Name: torS Funciton: Methyl-accepting chemotaxis protein |
||||
| torS | -2 | 5.3 | AAATGATAATAGTTATAATCT | VIBHAR_05136 |
| Vibrio parahaemolyticus RIMD 2210633 | ||||
|
Position: -40
Score: 4.47896 Sequence: TAATAATAATGATAATAATCA
Locus tag: VPA1462
Name: torS Funciton: Methyl-accepting chemotaxis protein |
||||
| torS | -40 | 4.5 | TAATAATAATGATAATAATCA | VPA1462 |
| Vibrio vulnificus CMCP6 | ||||
|
Position: -49
Score: 5.20015 Sequence: CAATAATATTCATTCTCATTA
Locus tag: VV21555
Name: torS Funciton: Methyl-accepting chemotaxis protein |
||||
| torS | -49 | 5.2 | CAATAATATTCATTCTCATTA | VV21555 |