Orthologous regulated operons containing PBPRB1815 gene
| Regulog: | Fur - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Photobacterium profundum SS9 | ||||
|
Position: -121
Score: 5.31972 Sequence: GATTGATAACTATTTTTATTT
Locus tag: PBPRB1816
Name: PBPRB1816 Funciton: Ferrichrome transport system permease protein FhuB (TC 3.A.1.14.3)
Locus tag: PBPRB1815
Name: PBPRB1815 Funciton: ABC-type Fe3+-siderophore transport system, permease component
Locus tag: PBPRB1814
Name: VIBHAR_01766 Funciton: Ferrichrome transport ATP-binding protein FhuC (TC 3.A.1.14.3) |
||||
| PBPRB1816-PBPRB1815-VIBHAR_01766 | -121 | 5.3 | GATTGATAACTATTTTTATTT | PBPRB1816 |