Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing frdC gene

Properties
Regulog: Fur - Vibrionales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor (activator)
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Proteobacteria/Gamma
Built upon 447 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Vibrio fischeri ES114
Position: -298
Score: 5.25694
Sequence: CAATAAGAATCATTATCACTT
Locus tag: VF_2334
Name: frdA
Funciton: fumarate reductase, flavoprotein subunit
Locus tag: VF_2335
Name: frdB
Funciton: fumarate reductase, iron-sulfur protein
Locus tag: VF_2336
Name: frdC
Funciton: fumarate reductase, 15 kDa hydrophobic protein
Locus tag: VF_2337
Name: frdD
Funciton: fumarate reductase, 13 kDa hydrophobic protein
frdA-frdB-frdC-frdD -298 5.3 CAATAAGAATCATTATCACTT VF_2334
Vibrio salmonicida LFI1238
Position: -256
Score: 4.86504
Sequence: CGATAAGAATCATTATCACTT
Locus tag: VSAL_I2788
Name: frdA
Funciton: fumarate reductase, flavoprotein subunit
Locus tag: VSAL_I2789
Name: frdB
Funciton: fumarate reductase, iron-sulfur protein
Locus tag: VSAL_I2790
Name: frdC
Funciton: fumarate reductase, 15 kDa hydrophobic protein
Locus tag: VSAL_I2791
Name: frdD
Funciton: fumarate reductase, 13 kDa hydrophobic protein
frdA-frdB-frdC-frdD -256 4.9 CGATAAGAATCATTATCACTT VSAL_I2788
Vibrio shilonii AK1
Position: -256
Score: 4.85498
Sequence: AAATCATAATTAAACTCATTA
Locus tag: VSAK1_11298
Name: frdA
Funciton: fumarate reductase, flavoprotein subunit
Locus tag: VSAK1_11293
Name: frdB
Funciton: fumarate reductase, iron-sulfur protein
Locus tag: VSAK1_11288
Name: frdC
Funciton: fumarate reductase, 15 kDa hydrophobic protein
Locus tag: VSAK1_11283
Name: frdD
Funciton: fumarate reductase, 13 kDa hydrophobic protein
frdA-frdB-frdC-frdD -256 4.9 AAATCATAATTAAACTCATTA VSAK1_11298