Orthologous regulated operons containing VV20565 gene
| Regulog: | Fur - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio harveyi ATCC BAA-1116 | ||||
|
Position: -197
Score: 4.57184 Sequence: CAATGTAAATGGTTCTCAATT
Locus tag: VIBHAR_06272
Name: VV20568 Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
Locus tag: VIBHAR_06271
Name: VV20567 Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
Locus tag: VIBHAR_06270
Name: VV20566 Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Locus tag: VIBHAR_06269
Name: VV20565 Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
||||
| VV20568-VV20567-VV20566-VV20565 | -197 | 4.6 | CAATGTAAATGGTTCTCAATT | VIBHAR_06272 |
| Vibrio parahaemolyticus RIMD 2210633 | ||||
|
Position: -252
Score: 5.00459 Sequence: TAATGTAAATGGTTCTCAATT
Locus tag: VPA0536
Name: VV20568 Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
Locus tag: VPA0537
Name: VV20567 Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
Locus tag: VPA0538
Name: VV20566 Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Locus tag: VPA0539
Name: VV20565 Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
||||
| VV20568-VV20567-VV20566-VV20565 | -252 | 5 | TAATGTAAATGGTTCTCAATT | VPA0536 |
| Vibrio vulnificus CMCP6 | ||||
|
Position: -317
Score: 6.20547 Sequence: AAATGATAATAAATATCATTT
Locus tag: VV20568
Name: VV20568 Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
Locus tag: VV20567
Name: VV20567 Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
Locus tag: VV20566
Name: VV20566 Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Locus tag: VV20565
Name: VV20565 Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
||||
| VV20568-VV20567-VV20566-VV20565 | -317 | 6.2 | AAATGATAATAAATATCATTT | VV20568 |