Orthologous regulated operons containing VV20565 gene

Properties
Regulog:	Fur - Vibrionales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor (activator)
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Proteobacteria/Gamma

Built upon 447 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Vibrio harveyi ATCC BAA-1116
Position: -197 Score: 4.57184 Sequence: CAATGTAAATGGTTCTCAATT Locus tag: VIBHAR_06272 Name: VV20568 Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) Locus tag: VIBHAR_06271 Name: VV20567 Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) Locus tag: VIBHAR_06270 Name: VV20566 Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 Locus tag: VIBHAR_06269 Name: VV20565 Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
VV20568-VV20567-VV20566-VV20565	-197	4.6	CAATGTAAATGGTTCTCAATT	VIBHAR_06272
Vibrio parahaemolyticus RIMD 2210633
Position: -252 Score: 5.00459 Sequence: TAATGTAAATGGTTCTCAATT Locus tag: VPA0536 Name: VV20568 Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) Locus tag: VPA0537 Name: VV20567 Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) Locus tag: VPA0538 Name: VV20566 Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 Locus tag: VPA0539 Name: VV20565 Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
VV20568-VV20567-VV20566-VV20565	-252	5	TAATGTAAATGGTTCTCAATT	VPA0536
Vibrio vulnificus CMCP6
Position: -317 Score: 6.20547 Sequence: AAATGATAATAAATATCATTT Locus tag: VV20568 Name: VV20568 Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) Locus tag: VV20567 Name: VV20567 Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) Locus tag: VV20566 Name: VV20566 Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 Locus tag: VV20565 Name: VV20565 Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
VV20568-VV20567-VV20566-VV20565	-317	6.2	AAATGATAATAAATATCATTT	VV20568