Orthologous regulated operons containing VSAK1_04950 gene
| Regulog: | Fur - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio angustum S14 | ||||
|
Position: -27
Score: 5.6407 Sequence: AAATGATAATTCATCTCATTT
Locus tag: VAS14_12284
Name: VSAK1_04950 Funciton: TonB-dependent siderophore receptor |
||||
| VSAK1_04950 | -27 | 5.6 | AAATGATAATTCATCTCATTT | VAS14_12284 |
| Vibrio shilonii AK1 | ||||
|
Position: -108
Score: 5.84242 Sequence: AAATGATAATAAATAGCATTA
Locus tag: VSAK1_04950
Name: VSAK1_04950 Funciton: TonB-dependent siderophore receptor |
||||
| VSAK1_04950 | -108 | 5.8 | AAATGATAATAAATAGCATTA | VSAK1_04950 |