Orthologous regulated operons containing VPA1662 gene
| Regulog: | Fur - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio parahaemolyticus RIMD 2210633 | ||||
|
Position: -208
Score: 5.54018 Sequence: AAATAAGAACAAATATTATTT
Locus tag: VPA1658
Name: VPA1658 Funciton: Vibrioferrin ligase/carboxylase protein PvsA
Locus tag: VPA1659
Name: VPA1659 Funciton: Vibrioferrin amide bond forming protein PvsB @ Siderophore synthetase superfamily, group B
Locus tag: VPA1660
Name: VPA1660 Funciton: Vibrioferrin membrane-spanning transport protein PvsC
Locus tag: VPA1661
Name: VPA1661 Funciton: Vibrioferrin amide bond forming protein PvsD @ Siderophore synthetase superfamily, group A
Locus tag: VPA1662
Name: VPA1662 Funciton: Vibrioferrin decarboxylase protein PvsE |
||||
| VPA1658-VPA1659-VPA1660-VPA1661-VPA1662 | -208 | 5.5 | AAATAAGAACAAATATTATTT | VPA1658 |
| Vibrio splendidus LGP32 | ||||
|
Position: -211
Score: 5.35018 Sequence: GAATAAGAACAAATATCATTT
Locus tag: VS_II1129
Name: VPA1658 Funciton: Vibrioferrin ligase/carboxylase protein PvsA
Locus tag: VS_II1130
Name: VPA1659 Funciton: Vibrioferrin amide bond forming protein PvsB @ Siderophore synthetase superfamily, group B
Locus tag: VS_II1131
Name: VPA1660 Funciton: Vibrioferrin membrane-spanning transport protein PvsC
Locus tag: VS_II1132
Name: VPA1661 Funciton: Vibrioferrin amide bond forming protein PvsD @ Siderophore synthetase superfamily, group A
Locus tag: VS_II1133
Name: VPA1662 Funciton: Vibrioferrin decarboxylase protein PvsE |
||||
| VPA1658-VPA1659-VPA1660-VPA1661-VPA1662 | -211 | 5.4 | GAATAAGAACAAATATCATTT | VS_II1129 |