Orthologous regulated operons containing VPA1434 gene
| Regulog: | Fur - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor (activator) |
| Biological process: | Iron homeostasis |
| Effector: | Iron ion, (Fe2+) |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Photobacterium profundum SS9 | ||||
|
Position: -160
Score: 5.40397 Sequence: TAATGATAATGATTGTCATCT
Locus tag: PBPRA1567
Name: null Funciton: putative hemolysin secretion ATP-binding protein |
||||
| PBPRA1567 | -160 | 5.4 | TAATGATAATGATTGTCATCT | PBPRA1567 |
| Vibrio parahaemolyticus RIMD 2210633 | ||||
|
Position: -109
Score: 5.45153 Sequence: TAATTGTAATTATTATCATTT
Locus tag: VPA1434
Name: null Funciton: putative hemolysin secretion ATP-binding protein |
||||
| VPA1434 | -109 | 5.5 | TAATTGTAATTATTATCATTT | VPA1434 |