Orthologous regulated operons containing ABC0466 gene
Regulog: | GudR - Bacillales |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | repressor |
Biological process: | Glucarate utilization; Galactarate utilization |
Effector: | |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Bacillus clausii KSM-K16 | ||||
Position: -50
Score: 5.94845 Sequence: TCTATTTGTCTTACAATTAAT
Locus tag: ABC0466
Name: ABC0466 Funciton: Putative mannonate dehydratase (EC 4.2.1.8) |
||||
ABC0466 | -50 | 5.9 | TCTATTTGTCTTACAATTAAT | ABC0466 |