Orthologous regulated operons containing SA1745 gene
| Regulog: | YtrA - Staphylococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Hypothetical ABC transporter |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Staphylococcus aureus subsp. aureus N315 | ||||
|
Position: -42
Score: 6.76542 Sequence: TGTGTATATTGTATATATACA
Locus tag: SA1748
Name: ytrA Funciton: transcription regulator GntR family
Locus tag: SA1747
Name: ytrB Funciton: ABC transporter (ATP-binding protein)
Locus tag: SA1746
Name: SA1746 Funciton: putative membrane protein
Locus tag: SA1745
Name: SA1745 Funciton: ABC transporter (ATP-binding protein)
Locus tag: SA1744
Name: SA1744 Funciton: putative membrane protein |
||||
| ytrA-ytrB-SA1746-SA1745-SA1744 | -42 | 6.8 | TGTGTATATTGTATATATACA | SA1748 |
| Staphylococcus capitis SK14 | ||||
|
Position: -40
Score: 6.97084 Sequence: TGTATATATTATGTATATACA
Locus tag: STACA0001_1986
Name: ytrA Funciton: transcription regulator GntR family
Locus tag: STACA0001_1985
Name: ytrB Funciton: ABC transporter (ATP-binding protein)
Locus tag: STACA0001_1984
Name: SA1746 Funciton: putative membrane protein
Locus tag: STACA0001_1983
Name: SA1745 Funciton: ABC transporter (ATP-binding protein)
Locus tag: STACA0001_1982
Name: SA1744 Funciton: putative membrane protein |
||||
| ytrA-ytrB-SA1746-SA1745-SA1744 | -40 | 7 | TGTATATATTATGTATATACA | STACA0001_1986 |
| Staphylococcus carnosus subsp. carnosus TM300 | ||||
|
Position: -128
Score: 6.90576 Sequence: TGTATATATACAATATATACA
Position: -38
Score: 6.81284 Sequence: TGTGTATACTGTGTATATACA
Locus tag: Sca_1508
Name: ytrA Funciton: transcription regulator GntR family
Locus tag: Sca_1507
Name: ytrB Funciton: ABC transporter (ATP-binding protein)
Locus tag: Sca_1506
Name: SA1746 Funciton: putative membrane protein
Locus tag: Sca_1505
Name: SA1745 Funciton: ABC transporter (ATP-binding protein)
Locus tag: Sca_1504
Name: SA1744 Funciton: putative membrane protein |
||||
| ytrA-ytrB-SA1746-SA1745-SA1744 | -128 | 6.9 | TGTATATATACAATATATACA | Sca_1508 |
| -38 | 6.8 | TGTGTATACTGTGTATATACA | ||
| Staphylococcus epidermidis ATCC 12228 | ||||
|
Position: -40
Score: 6.97084 Sequence: TGTATATATTATGTATATACA
Locus tag: SE1625
Name: ytrA Funciton: transcription regulator GntR family
Locus tag: SE1624
Name: ytrB Funciton: ABC transporter (ATP-binding protein)
Locus tag: SE1623
Name: SA1746 Funciton: putative membrane protein
Locus tag: SE1622
Name: SA1745 Funciton: ABC transporter (ATP-binding protein)
Locus tag: SE1621
Name: SA1744 Funciton: putative membrane protein |
||||
| ytrA-ytrB-SA1746-SA1745-SA1744 | -40 | 7 | TGTATATATTATGTATATACA | SE1625 |
| Staphylococcus haemolyticus JCSC1435 | ||||
|
Position: -127
Score: 6.40287 Sequence: TGTATCTATAATGTATATACA
Position: -41
Score: 6.59051 Sequence: TGTGTATACTATTTATATACA
Locus tag: SH1021
Name: ytrA Funciton: transcription regulator GntR family
Locus tag: SH1022
Name: ytrB Funciton: ABC transporter (ATP-binding protein)
Locus tag: SH1023
Name: SA1746 Funciton: putative membrane protein
Locus tag: SH1024
Name: SA1745 Funciton: ABC transporter (ATP-binding protein)
Locus tag: SH1025
Name: SA1744 Funciton: putative membrane protein |
||||
| ytrA-ytrB-SA1746-SA1745-SA1744 | -127 | 6.4 | TGTATCTATAATGTATATACA | SH1021 |
| -41 | 6.6 | TGTGTATACTATTTATATACA | ||
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | ||||
|
Position: -40
Score: 6.68949 Sequence: TGTATATATTGCGTATATACA
Locus tag: SSP0856
Name: ytrA Funciton: transcription regulator GntR family
Locus tag: SSP0857
Name: ytrB Funciton: ABC transporter (ATP-binding protein)
Locus tag: SSP0858
Name: ytrB Funciton: ABC transporter (ATP-binding protein)
Locus tag: SSP0859
Name: SA1746 Funciton: putative membrane protein
Locus tag: SSP0860
Name: SA1745 Funciton: ABC transporter (ATP-binding protein)
Locus tag: SSP0861
Name: SA1744 Funciton: putative membrane protein |
||||
| ytrA-ytrB-ytrB-SA1746-SA1745-SA1744 | -40 | 6.7 | TGTATATATTGCGTATATACA | SSP0856 |