Orthologous regulated operons containing Rcas_0478 gene

Properties
Regulog:	NagR - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine
Phylum:	Chloroflexi

Built upon 5 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Roseiflexus castenholzii DSM 13941
Position: -132 Score: 6.87794 Sequence: TTGTCAGTTCAATGGACTAACAC Locus tag: Rcas_0477 Name: nagR Funciton: Predicted N-acetyl-glucosamine repressor, ROK family Locus tag: Rcas_0478 Name: Rcas_0478 Funciton: Predicted N-acetylglucosamine ABC transporter, sugar-binding component
nagR-Rcas_0478	-132	6.9	TTGTCAGTTCAATGGACTAACAC	Rcas_0477
Roseiflexus sp. RS-1
Position: -126 Score: 6.67461 Sequence: TTGTCAGTTCACTGAACTAATGA Locus tag: RoseRS_4247 Name: nagR Funciton: Predicted N-acetyl-glucosamine repressor, ROK family Locus tag: RoseRS_4248 Name: Rcas_0478 Funciton: Predicted N-acetylglucosamine ABC transporter, sugar-binding component
nagR-Rcas_0478	-126	6.7	TTGTCAGTTCACTGAACTAATGA	RoseRS_4247

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --