Orthologous regulated operons containing hex2 gene
| Regulog: | NagR - Chloroflexia |
| Regulator type: | Transcription factor |
| Regulator family: | ROK |
| Regulation mode: | |
| Biological process: | N-acetylglucosamine utilization |
| Effector: | N-acetylglucosamine |
| Phylum: | Chloroflexi |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Chloroflexus sp. Y-400-fl | ||||
|
Position: -39
Score: 6.77627 Sequence: TTGTTAGTTCATTGGACTATCTA
Locus tag: Chy400_1208
Name: nagR Funciton: Predicted N-acetyl-glucosamine repressor, ROK family
Locus tag: Chy400_1209
Name: age Funciton: N-acylglucosamine 2-epimerase (EC 5.1.3.8)
Locus tag: Chy400_1210
Name: null Funciton: hypothetical protein
Locus tag: Chy400_1211
Name: chiE Funciton: Predicted chitobiose ABC transport system, sugar-binding protein (Thermotoga-like)
Locus tag: Chy400_1212
Name: chiF Funciton: Predicted chitobiose ABC transport system, permease protein 1 (Thermotoga-like)
Locus tag: Chy400_1213
Name: chiG Funciton: Predicted chitobiose ABC transport system, permease protein 2 (Thermotoga-like)
Locus tag: Chy400_1214
Name: null Funciton: glycoside hydrolase family 38
Locus tag: Chy400_1215
Name: hex2 Funciton: Beta-hexosaminidase
Locus tag: Chy400_1216
Name: nagB Funciton: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6) |
||||
| nagR-age-Chy400_1210-chiE-chiF-chiG-Chy400_1214-hex2-nagB | -39 | 6.8 | TTGTTAGTTCATTGGACTATCTA | Chy400_1208 |