Orthologous regulated operons containing Chy400_1214 gene

Properties
Regulog:	NagR - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine
Phylum:	Chloroflexi

Built upon 5 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Chloroflexus sp. Y-400-fl
Position: -39 Score: 6.77627 Sequence: TTGTTAGTTCATTGGACTATCTA Locus tag: Chy400_1208 Name: nagR Funciton: Predicted N-acetyl-glucosamine repressor, ROK family Locus tag: Chy400_1209 Name: age Funciton: N-acylglucosamine 2-epimerase (EC 5.1.3.8) Locus tag: Chy400_1210 Name: null Funciton: hypothetical protein Locus tag: Chy400_1211 Name: chiE Funciton: Predicted chitobiose ABC transport system, sugar-binding protein (Thermotoga-like) Locus tag: Chy400_1212 Name: chiF Funciton: Predicted chitobiose ABC transport system, permease protein 1 (Thermotoga-like) Locus tag: Chy400_1213 Name: chiG Funciton: Predicted chitobiose ABC transport system, permease protein 2 (Thermotoga-like) Locus tag: Chy400_1214 Name: null Funciton: glycoside hydrolase family 38 Locus tag: Chy400_1215 Name: hex2 Funciton: Beta-hexosaminidase Locus tag: Chy400_1216 Name: nagB Funciton: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
nagR-age-Chy400_1210-chiE-chiF-chiG-Chy400_1214-hex2-nagB	-39	6.8	TTGTTAGTTCATTGGACTATCTA	Chy400_1208

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --