Orthologous regulated operons containing Haur_1418 gene
Regulog: | Caur_1157 - Chloroflexia |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Beta-glucosides utilization |
Effector: | Beta-glucoside |
Phylum: | Chloroflexi |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Herpetosiphon aurantiacus ATCC 23779 | ||||
Position: -41
Score: 5.21538 Sequence: TATTGAGACCGATTCCAATG
Locus tag: Haur_1418
Name: null Funciton: Cellulose 1,4-beta-cellobiosidase precursor (EC 3.2.1.91) |
||||
Haur_1418 | -41 | 5.2 | TATTGAGACCGATTCCAATG | Haur_1418 |