Orthologous regulated operons containing Haur_0301 gene
Regulog: | Caur_1157 - Chloroflexia |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Beta-glucosides utilization |
Effector: | Beta-glucoside |
Phylum: | Chloroflexi |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Herpetosiphon aurantiacus ATCC 23779 | ||||
Position: -347
Score: 6.03787 Sequence: CATTGAGACCGCTCCCAATG
Position: -271
Score: 5.69641 Sequence: GAATGAGATCGCTCCCAAGC
Locus tag: Haur_0297
Name: Caur_1157 Funciton: Predicted transcriptional regulator for beta-glucoside utilization, LacI family
Locus tag: Haur_0298
Name: Haur_0298 Funciton: Sugar ABC transport system, sugar-binding protein
Locus tag: Haur_0299
Name: null Funciton: Sugar ABC transporter permease
Locus tag: Haur_0300
Name: Haur_0300 Funciton: binding-protein-dependent transport systems inner membrane component
Locus tag: Haur_0301
Name: null Funciton: hypothetical protein |
||||
Caur_1157-Haur_0298-Haur_0299-Haur_0300-Haur_0301 | -347 | 6 | CATTGAGACCGCTCCCAATG | Haur_0297 |
-271 | 5.7 | GAATGAGATCGCTCCCAAGC |