Orthologous regulated operons containing bglB gene

Properties
Regulog:	Caur_1157 - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Phylum:	Chloroflexi

Built upon 7 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Chloroflexus aggregans DSM 9485
Position: -119 Score: 5.57077 Sequence: CCCTGGAAGCGCTTTCACGG Locus tag: Cagg_1685 Name: Caur_1157 Funciton: Predicted transcriptional regulator for beta-glucoside utilization, LacI family Locus tag: Cagg_1686 Name: null Funciton: extracellular solute-binding protein family 1 Locus tag: Cagg_1687 Name: null Funciton: binding-protein-dependent transport systems inner membrane component Locus tag: Cagg_1688 Name: null Funciton: binding-protein-dependent transport systems inner membrane component Locus tag: Cagg_1689 Name: null Funciton: glycoside hydrolase family 3 domain protein Locus tag: Cagg_1690 Name: null Funciton: glycoside hydrolase family 16 Locus tag: Cagg_1691 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21)
Caur_1157-Cagg_1686-Cagg_1687-Cagg_1688-Cagg_1689-Cagg_1690-bglB	-119	5.6	CCCTGGAAGCGCTTTCACGG	Cagg_1685
Chloroflexus sp. Y-400-fl
Position: -117 Score: 5.57077 Sequence: GACTGGAAGCGCTTTCACGG Locus tag: Chy400_1181 Name: Caur_1157 Funciton: Predicted transcriptional regulator for beta-glucoside utilization, LacI family Locus tag: Chy400_1180 Name: null Funciton: extracellular solute-binding protein family 1 Locus tag: Chy400_1179 Name: null Funciton: binding-protein-dependent transport systems inner membrane component Locus tag: Chy400_1178 Name: null Funciton: binding-protein-dependent transport systems inner membrane component Locus tag: Chy400_1177 Name: null Funciton: glycoside hydrolase family 3 domain protein Locus tag: Chy400_1176 Name: null Funciton: glycoside hydrolase family 16 Locus tag: Chy400_1175 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21)
Caur_1157-Chy400_1180-Chy400_1179-Chy400_1178-Chy400_1177-Chy400_1176-bglB	-117	5.6	GACTGGAAGCGCTTTCACGG	Chy400_1181