Orthologous regulated operons containing Chy400_1177 gene
| Regulog: | Caur_1157 - Chloroflexia |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside |
| Phylum: | Chloroflexi |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Chloroflexus aggregans DSM 9485 | ||||
|
Position: -119
Score: 5.57077 Sequence: CCCTGGAAGCGCTTTCACGG
Locus tag: Cagg_1685
Name: Caur_1157 Funciton: Predicted transcriptional regulator for beta-glucoside utilization, LacI family
Locus tag: Cagg_1686
Name: null Funciton: extracellular solute-binding protein family 1
Locus tag: Cagg_1687
Name: null Funciton: binding-protein-dependent transport systems inner membrane component
Locus tag: Cagg_1688
Name: null Funciton: binding-protein-dependent transport systems inner membrane component
Locus tag: Cagg_1689
Name: null Funciton: glycoside hydrolase family 3 domain protein
Locus tag: Cagg_1690
Name: null Funciton: glycoside hydrolase family 16
Locus tag: Cagg_1691
Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21) |
||||
| Caur_1157-Cagg_1686-Cagg_1687-Cagg_1688-Cagg_1689-Cagg_1690-bglB | -119 | 5.6 | CCCTGGAAGCGCTTTCACGG | Cagg_1685 |
| Chloroflexus sp. Y-400-fl | ||||
|
Position: -117
Score: 5.57077 Sequence: GACTGGAAGCGCTTTCACGG
Locus tag: Chy400_1181
Name: Caur_1157 Funciton: Predicted transcriptional regulator for beta-glucoside utilization, LacI family
Locus tag: Chy400_1180
Name: null Funciton: extracellular solute-binding protein family 1
Locus tag: Chy400_1179
Name: null Funciton: binding-protein-dependent transport systems inner membrane component
Locus tag: Chy400_1178
Name: null Funciton: binding-protein-dependent transport systems inner membrane component
Locus tag: Chy400_1177
Name: null Funciton: glycoside hydrolase family 3 domain protein
Locus tag: Chy400_1176
Name: null Funciton: glycoside hydrolase family 16
Locus tag: Chy400_1175
Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21) |
||||
| Caur_1157-Chy400_1180-Chy400_1179-Chy400_1178-Chy400_1177-Chy400_1176-bglB | -117 | 5.6 | GACTGGAAGCGCTTTCACGG | Chy400_1181 |