Orthologous regulated operons containing CPF_1128 gene
| Regulog: | Zur - Clostridia-1 |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Clostridium perfringens ATCC 13124 | ||||
|
Position: -85
Score: 5.58303 Sequence: CAATTGAAAATAATTATCAAATT
Locus tag: CPF_1128
Name: null Funciton: conserved hypothetical protein
Locus tag: CPF_1127
Name: feoA Funciton: ferrous iron transport protein A
Locus tag: CPF_1126
Name: feoA2 Funciton: Ferrous iron transport protein A |
||||
| CPF_1128-feoA-feoA2 | -85 | 5.6 | CAATTGAAAATAATTATCAAATT | CPF_1128 |