Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing scrA2 gene

Properties
Regulog: ScrR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Phylum: Firmicutes
Built upon 16 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Macrococcus caseolyticus JCSC5402
Position: -30
Score: 6.13774
Sequence: AAATGGAACCGGTTCCAAAG
Locus tag: MCCL_0373
Name: scrB
Funciton: sucrose-6-phosphate hydrolase
Locus tag: MCCL_0374
Name: scrK
Funciton: fructokinase
Locus tag: MCCL_0375
Name: scrA2
Funciton: non-orthologous PTS system sucrose-specific IIBC component
scrB-scrK-scrA2 -30 6.1 AAATGGAACCGGTTCCAAAG MCCL_0373
© 2009-2020 RegPrecise