Orthologous regulated operons containing ykuF gene
Regulog: | FadR - Bacillales |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Fatty acid degradation |
Effector: | Palmitoyl-CoA; Oleoyl-CoA |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Anoxybacillus flavithermus WK1 | ||||
Position: -37
Score: 6.46666 Sequence: ATGAATGAATAACCATTCAT
Locus tag: Aflv_1909
Name: null Funciton: short chain dehydrogenase |
||||
Aflv_1909 | -37 | 6.5 | ATGAATGAATAACCATTCAT | Aflv_1909 |
Bacillus amyloliquefaciens FZB42 | ||||
Position: -40
Score: 6.76901 Sequence: ATGAATGATTATTCATTCAA
Locus tag: RBAM_013850
Name: ykuF Funciton: 2,4-dienoyl-CoA reductase, mitochondrial precursor (EC 1.3.1.34) |
||||
ykuF | -40 | 6.8 | ATGAATGATTATTCATTCAA | RBAM_013850 |
Bacillus cereus ATCC 14579 | ||||
Position: -29
Score: 5.17853 Sequence: ATGAATGTGTATTCATTTTT
Locus tag: BC3990
Name: null Funciton: 2,4-dienoyl-CoA reductase [NADPH] |
||||
BC3990 | -29 | 5.2 | ATGAATGTGTATTCATTTTT | BC3990 |
Bacillus halodurans C-125 | ||||
Position: -38
Score: 6.82559 Sequence: TTGAATGAATATTCATTCAA
Locus tag: BH2144
Name: BH2144 Funciton: 2,4-dienoyl-CoA reductase (NADPH) |
||||
BH2144 | -38 | 6.8 | TTGAATGAATATTCATTCAA | BH2144 |
Bacillus licheniformis DSM 13 | ||||
Position: -36
Score: 6.81767 Sequence: TTGAATGAATACTCATTCAT
Locus tag: BLi01620
Name: ykuF Funciton: Oxidoreductase, short chain dehydrogenase/reductase family |
||||
ykuF | -36 | 6.8 | TTGAATGAATACTCATTCAT | BLi01620 |
Bacillus pumilus SAFR-032 | ||||
Position: -40
Score: 6.74862 Sequence: ATGAATGAATAGTCATTCAA
Locus tag: BPUM_1303
Name: ykuF Funciton: short chain dehydrogenase |
||||
ykuF | -40 | 6.7 | ATGAATGAATAGTCATTCAA | BPUM_1303 |
Bacillus subtilis subsp. subtilis str. 168 | ||||
Position: -36
Score: 6.4225 Sequence: TTGAATGAATAATCATTCAC
Locus tag: BSU14060
Name: ykuF Funciton: 2,4-dienoyl-CoA reductase, mitochondrial precursor (EC 1.3.1.34)
Locus tag: BSU14071
Name: fadG Funciton: hypothetical protein |
||||
ykuF-fadG | -36 | 6.4 | TTGAATGAATAATCATTCAC | BSU14060 |
Geobacillus kaustophilus HTA426 | ||||
Position: -34
Score: 6.49459 Sequence: ATGAATGAGTAATCAGTCAT
Locus tag: GK1044
Name: null Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family |
||||
GK1044 | -34 | 6.5 | ATGAATGAGTAATCAGTCAT | GK1044 |