Orthologous regulated operons containing metB gene
| Regulog: | CmbR - Streptococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LysR |
| Regulation mode: | repressor (activator) |
| Biological process: | Cysteine metabolism |
| Effector: | O-acetyl-L-serine |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptococcus gallolyticus UCN34 | ||||
|
Position: -142
Score: 5.00573 Sequence: GTTATAGTTTTTACTTATAGC
Locus tag: GALLO_1768
Name: metB Funciton: Cystathionine gamma-synthase (EC 2.5.1.48)
Locus tag: GALLO_1767
Name: metC Funciton: L-cysteine desulfhydrase |
||||
| metB-metC | -142 | 5 | GTTATAGTTTTTACTTATAGC | GALLO_1768 |
| Streptococcus mutans UA159 | ||||
|
Position: -110
Score: 4.28317 Sequence: CTTATAGTTTCTTTTTATAGC
Locus tag: SMU.1675
Name: metB Funciton: Cystathionine gamma-synthase (EC 2.5.1.48)
Locus tag: SMU.1674
Name: metC Funciton: L-cysteine desulfhydrase |
||||
| metB-metC | -110 | 4.3 | CTTATAGTTTCTTTTTATAGC | SMU.1675 |
| Streptococcus suis 05ZYH33 | ||||
|
Position: -120
Score: 5.05408 Sequence: GTTATAAAGAAAAACTATAAC
Locus tag: SSU05_1562
Name: metB Funciton: Cystathionine gamma-synthase (EC 2.5.1.48)
Locus tag: SSU05_1561
Name: metC Funciton: L-cysteine desulfhydrase |
||||
| metB-metC | -120 | 5.1 | GTTATAAAGAAAAACTATAAC | SSU05_1562 |
| Streptococcus thermophilus CNRZ1066 | ||||
|
Position: -132
Score: 4.48483 Sequence: GTTATAGTAATAAACTATATC
Locus tag: str0352
Name: metB Funciton: Cystathionine gamma-synthase (EC 2.5.1.48)
Locus tag: str0353
Name: metC Funciton: L-cysteine desulfhydrase |
||||
| metB-metC | -132 | 4.5 | GTTATAGTAATAAACTATATC | str0352 |