Orthologous regulated operons containing mtlF gene
| Regulog: | MtlR - Staphylococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | BglG |
| Regulation mode: | activator |
| Biological process: | Mannitol utilization |
| Effector: | MtlA, mannitol-specific enzyme IICB PTS component; HPr, phosphocarrier protein |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Staphylococcus aureus subsp. aureus N315 | ||||
|
Position: -104
Score: 6.47731 Sequence: TTGTCACATTTATTTTGACAA
Locus tag: SA1960
Name: mtlF Funciton: mannitol specific PTS system, IIBC component
Locus tag: SA1961
Name: mtlR Funciton: transcriptional activator of mannitol operon, BglG family
Locus tag: SA1962
Name: mtlA Funciton: mannitol specific PTS system, IIA component
Locus tag: SA1963
Name: mtlD Funciton: mannitol-1-phosphate 5-dehydrogenase |
||||
| mtlF-mtlR-mtlA-mtlD | -104 | 6.5 | TTGTCACATTTATTTTGACAA | SA1960 |
| Staphylococcus capitis SK14 | ||||
|
Position: -108
Score: 6.1949 Sequence: TTGTCACAAATATCATGACAA
Locus tag: STACA0001_0858
Name: mtlF Funciton: mannitol specific PTS system, IIBC component
Locus tag: STACA0001_0859
Name: mtlR Funciton: transcriptional activator of mannitol operon, BglG family
Locus tag: STACA0001_0860
Name: mtlA Funciton: mannitol specific PTS system, IIA component
Locus tag: STACA0001_0861
Name: mtlD Funciton: mannitol-1-phosphate 5-dehydrogenase |
||||
| mtlF-mtlR-mtlA-mtlD | -108 | 6.2 | TTGTCACAAATATCATGACAA | STACA0001_0858 |
| Staphylococcus carnosus subsp. carnosus TM300 | ||||
|
Position: -105
Score: 5.26619 Sequence: ATGGCAACAATTCAGTGACAA
Locus tag: Sca_1658
Name: mtlF Funciton: mannitol specific PTS system, IIBC component
Locus tag: Sca_1659
Name: mtlR Funciton: transcriptional activator of mannitol operon, BglG family
Locus tag: Sca_1660
Name: mtlA Funciton: mannitol specific PTS system, IIA component
Locus tag: Sca_1661
Name: mtlD Funciton: mannitol-1-phosphate 5-dehydrogenase |
||||
| mtlF-mtlR-mtlA-mtlD | -105 | 5.3 | ATGGCAACAATTCAGTGACAA | Sca_1658 |
| Staphylococcus haemolyticus JCSC1435 | ||||
|
Position: -105
Score: 6.79543 Sequence: TTGTCACAATTACTGTGACAA
Locus tag: SH0235
Name: mtlF Funciton: mannitol specific PTS system, IIBC component
Locus tag: SH0234
Name: mtlR Funciton: transcriptional activator of mannitol operon, BglG family
Locus tag: SH0233
Name: mtlA Funciton: mannitol specific PTS system, IIA component
Locus tag: SH0232
Name: mtlD Funciton: mannitol-1-phosphate 5-dehydrogenase |
||||
| mtlF-mtlR-mtlA-mtlD | -105 | 6.8 | TTGTCACAATTACTGTGACAA | SH0235 |
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | ||||
|
Position: -106
Score: 6.57626 Sequence: TTGTCAAAGATACTGTGACAA
Locus tag: SSP0728
Name: mtlF Funciton: mannitol specific PTS system, IIBC component
Locus tag: SSP0727
Name: mtlR Funciton: transcriptional activator of mannitol operon, BglG family
Locus tag: SSP0726
Name: mtlA Funciton: mannitol specific PTS system, IIA component
Locus tag: SSP0725
Name: mtlD Funciton: mannitol-1-phosphate 5-dehydrogenase |
||||
| mtlF-mtlR-mtlA-mtlD | -106 | 6.6 | TTGTCAAAGATACTGTGACAA | SSP0728 |