Orthologous regulated operons containing mntH gene
| Regulog: | MntR - Staphylococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Macrococcus caseolyticus JCSC5402 | ||||
|
Position: -52
Score: 5.68233 Sequence: TTTTTAGGTTGCCCTAAAGA
Locus tag: MCCL_0368
Name: mntH Funciton: Mn2+/Fe2+ transporter, NRAMP family |
||||
| mntH | -52 | 5.7 | TTTTTAGGTTGCCCTAAAGA | MCCL_0368 |
| Staphylococcus aureus subsp. aureus N315 | ||||
|
Position: -67
Score: 6.28253 Sequence: AATTTAGGTTGACCTAAACA
Locus tag: SA0956
Name: mntH Funciton: Mn2+/Fe2+ transporter, NRAMP family |
||||
| mntH | -67 | 6.3 | AATTTAGGTTGACCTAAACA | SA0956 |
| Staphylococcus capitis SK14 | ||||
|
Position: -66
Score: 6.08709 Sequence: TTTTTAGGTTGACCTAACTT
Locus tag: STACA0001_2258
Name: mntH Funciton: Mn2+/Fe2+ transporter, NRAMP family |
||||
| mntH | -66 | 6.1 | TTTTTAGGTTGACCTAACTT | STACA0001_2258 |
| Staphylococcus carnosus subsp. carnosus TM300 | ||||
|
Position: -76
Score: 6.08709 Sequence: TTTTTAGGTTGACCTAACTT
Locus tag: Sca_0731
Name: mntH Funciton: Mn2+/Fe2+ transporter, NRAMP family |
||||
| mntH | -76 | 6.1 | TTTTTAGGTTGACCTAACTT | Sca_0731 |
| Staphylococcus epidermidis ATCC 12228 | ||||
|
Position: -51
Score: 6.33114 Sequence: TTTTTAGGTTGACCTAATAT
Position: -29
Score: 4.61618 Sequence: TATTTAGGTTAATATATTCT
Locus tag: SE0803
Name: mntH Funciton: Mn2+/Fe2+ transporter, NRAMP family |
||||
| mntH | -51 | 6.3 | TTTTTAGGTTGACCTAATAT | SE0803 |
| -29 | 4.6 | TATTTAGGTTAATATATTCT | ||
| Staphylococcus haemolyticus JCSC1435 | ||||
|
Position: -65
Score: 6.30942 Sequence: TTATTAGGTTGACCTAAAAA
Locus tag: SH1847
Name: mntH Funciton: Mn2+/Fe2+ transporter, NRAMP family |
||||
| mntH | -65 | 6.3 | TTATTAGGTTGACCTAAAAA | SH1847 |
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | ||||
|
Position: -73
Score: 6.30942 Sequence: TTTTTAGGTTGACCTAATAA
Locus tag: SSP1685
Name: mntH Funciton: Mn2+/Fe2+ transporter, NRAMP family |
||||
| mntH | -73 | 6.3 | TTTTTAGGTTGACCTAATAA | SSP1685 |