Orthologous regulated operons containing mntC gene
| Regulog: | MntR - Staphylococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Macrococcus caseolyticus JCSC5402 | ||||
|
Position: -52
Score: 5.8918 Sequence: AGTTTAGGTTTGCCTAAAAT
Locus tag: MCCL_0095
Name: mntA Funciton: manganese ABC transport system ATPase component MntA
Locus tag: MCCL_0094
Name: mntB Funciton: manganese ABC transport system membrane protein MntB
Locus tag: MCCL_0093
Name: mntC Funciton: manganese ABC transport system substrate-binding protein MntC |
||||
| mntA-mntB-mntC | -52 | 5.9 | AGTTTAGGTTTGCCTAAAAT | MCCL_0095 |
| Staphylococcus aureus subsp. aureus N315 | ||||
|
Position: -42
Score: 6.12446 Sequence: TAATTAGGTTAGCCTAAACT
Locus tag: SA0589
Name: mntA Funciton: manganese ABC transport system ATPase component MntA
Locus tag: SA0588
Name: mntB Funciton: manganese ABC transport system membrane protein MntB
Locus tag: SA0587
Name: mntC Funciton: manganese ABC transport system substrate-binding protein MntC |
||||
| mntA-mntB-mntC | -42 | 6.1 | TAATTAGGTTAGCCTAAACT | SA0589 |
| Staphylococcus capitis SK14 | ||||
|
Position: -42
Score: 6.14618 Sequence: AAATTAGGTTAGCCTAAACT
Locus tag: STACA0001_0395
Name: mntA Funciton: manganese ABC transport system ATPase component MntA
Locus tag: STACA0001_0396
Name: mntB Funciton: manganese ABC transport system membrane protein MntB
Locus tag: STACA0001_0397
Name: mntC Funciton: manganese ABC transport system substrate-binding protein MntC |
||||
| mntA-mntB-mntC | -42 | 6.1 | AAATTAGGTTAGCCTAAACT | STACA0001_0395 |
| Staphylococcus carnosus subsp. carnosus TM300 | ||||
|
Position: -141
Score: 6.22598 Sequence: AAATTAGGTTAGCCTAAAAA
Locus tag: Sca_0275
Name: mntA Funciton: manganese ABC transport system ATPase component MntA
Locus tag: Sca_0274
Name: mntB Funciton: manganese ABC transport system membrane protein MntB
Locus tag: Sca_0273
Name: mntC Funciton: manganese ABC transport system substrate-binding protein MntC |
||||
| mntA-mntB-mntC | -141 | 6.2 | AAATTAGGTTAGCCTAAAAA | Sca_0275 |
| Staphylococcus epidermidis ATCC 12228 | ||||
|
Position: -42
Score: 6.36587 Sequence: AAATTAGGTTAACCTAAACT
Locus tag: SE0407
Name: mntA Funciton: manganese ABC transport system ATPase component MntA
Locus tag: SE0406
Name: mntB Funciton: manganese ABC transport system membrane protein MntB
Locus tag: SE0405
Name: mntC Funciton: manganese ABC transport system substrate-binding protein MntC |
||||
| mntA-mntB-mntC | -42 | 6.4 | AAATTAGGTTAACCTAAACT | SE0407 |
| Staphylococcus haemolyticus JCSC1435 | ||||
|
Position: -40
Score: 6.36587 Sequence: AAATTAGGTTAACCTAAACT
Locus tag: SH0143
Name: mntA Funciton: manganese ABC transport system ATPase component MntA
Locus tag: SH0142
Name: mntB Funciton: manganese ABC transport system membrane protein MntB
Locus tag: SH0141
Name: mntC Funciton: manganese ABC transport system substrate-binding protein MntC |
||||
| mntA-mntB-mntC | -40 | 6.4 | AAATTAGGTTAACCTAAACT | SH0143 |
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | ||||
|
Position: -40
Score: 6.22598 Sequence: AAATTAGGTTAGCCTAAAAA
Locus tag: SSP2086
Name: mntA Funciton: manganese ABC transport system ATPase component MntA
Locus tag: SSP2087
Name: mntB Funciton: manganese ABC transport system membrane protein MntB
Locus tag: SSP2088
Name: mntC Funciton: manganese ABC transport system substrate-binding protein MntC |
||||
| mntA-mntB-mntC | -40 | 6.2 | AAATTAGGTTAGCCTAAAAA | SSP2086 |