Orthologous regulated operons containing mntB gene

Properties
Regulog:	MntR - Staphylococcaceae
Regulator type:	Transcription factor
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Phylum:	Firmicutes

Built upon 15 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Macrococcus caseolyticus JCSC5402
Position: -52 Score: 5.8918 Sequence: AGTTTAGGTTTGCCTAAAAT Locus tag: MCCL_0095 Name: mntA Funciton: manganese ABC transport system ATPase component MntA Locus tag: MCCL_0094 Name: mntB Funciton: manganese ABC transport system membrane protein MntB Locus tag: MCCL_0093 Name: mntC Funciton: manganese ABC transport system substrate-binding protein MntC
mntA-mntB-mntC	-52	5.9	AGTTTAGGTTTGCCTAAAAT	MCCL_0095
Staphylococcus aureus subsp. aureus N315
Position: -42 Score: 6.12446 Sequence: TAATTAGGTTAGCCTAAACT Locus tag: SA0589 Name: mntA Funciton: manganese ABC transport system ATPase component MntA Locus tag: SA0588 Name: mntB Funciton: manganese ABC transport system membrane protein MntB Locus tag: SA0587 Name: mntC Funciton: manganese ABC transport system substrate-binding protein MntC
mntA-mntB-mntC	-42	6.1	TAATTAGGTTAGCCTAAACT	SA0589
Staphylococcus capitis SK14
Position: -42 Score: 6.14618 Sequence: AAATTAGGTTAGCCTAAACT Locus tag: STACA0001_0395 Name: mntA Funciton: manganese ABC transport system ATPase component MntA Locus tag: STACA0001_0396 Name: mntB Funciton: manganese ABC transport system membrane protein MntB Locus tag: STACA0001_0397 Name: mntC Funciton: manganese ABC transport system substrate-binding protein MntC
mntA-mntB-mntC	-42	6.1	AAATTAGGTTAGCCTAAACT	STACA0001_0395
Staphylococcus carnosus subsp. carnosus TM300
Position: -141 Score: 6.22598 Sequence: AAATTAGGTTAGCCTAAAAA Locus tag: Sca_0275 Name: mntA Funciton: manganese ABC transport system ATPase component MntA Locus tag: Sca_0274 Name: mntB Funciton: manganese ABC transport system membrane protein MntB Locus tag: Sca_0273 Name: mntC Funciton: manganese ABC transport system substrate-binding protein MntC
mntA-mntB-mntC	-141	6.2	AAATTAGGTTAGCCTAAAAA	Sca_0275
Staphylococcus epidermidis ATCC 12228
Position: -42 Score: 6.36587 Sequence: AAATTAGGTTAACCTAAACT Locus tag: SE0407 Name: mntA Funciton: manganese ABC transport system ATPase component MntA Locus tag: SE0406 Name: mntB Funciton: manganese ABC transport system membrane protein MntB Locus tag: SE0405 Name: mntC Funciton: manganese ABC transport system substrate-binding protein MntC
mntA-mntB-mntC	-42	6.4	AAATTAGGTTAACCTAAACT	SE0407
Staphylococcus haemolyticus JCSC1435
Position: -40 Score: 6.36587 Sequence: AAATTAGGTTAACCTAAACT Locus tag: SH0143 Name: mntA Funciton: manganese ABC transport system ATPase component MntA Locus tag: SH0142 Name: mntB Funciton: manganese ABC transport system membrane protein MntB Locus tag: SH0141 Name: mntC Funciton: manganese ABC transport system substrate-binding protein MntC
mntA-mntB-mntC	-40	6.4	AAATTAGGTTAACCTAAACT	SH0143
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Position: -40 Score: 6.22598 Sequence: AAATTAGGTTAGCCTAAAAA Locus tag: SSP2086 Name: mntA Funciton: manganese ABC transport system ATPase component MntA Locus tag: SSP2087 Name: mntB Funciton: manganese ABC transport system membrane protein MntB Locus tag: SSP2088 Name: mntC Funciton: manganese ABC transport system substrate-binding protein MntC
mntA-mntB-mntC	-40	6.2	AAATTAGGTTAGCCTAAAAA	SSP2086

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing mntB gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --