Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing gfoB gene

Properties
Regulog: MalR - Staphylococcaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Phylum: Firmicutes
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Macrococcus caseolyticus JCSC5402
Position: -110
Score: 6.66683
Sequence: TTATGCAATCGTTTGCAAAA
Locus tag: MCCL_0353
Name: mdxE
Funciton: Maltose/maltodextrin ABC transporter, substrate binding protein
Locus tag: MCCL_0354
Name: mdxF
Funciton: Maltose/maltodextrin ABC transporter, permease protein
Locus tag: MCCL_0355
Name: mdxG
Funciton: Maltose/maltodextrin ABC transporter, permease protein
Locus tag: MCCL_0356
Name: malR
Funciton: Maltose operon transcriptional repressor MalR, LacI family
Locus tag: MCCL_0357
Name: MCCL_0357
Funciton: trehalosemaltose utilization protein
Locus tag: MCCL_0358
Name: gfoA
Funciton: putative glucose dehydrogenase A
Locus tag: MCCL_0359
Name: gfoB
Funciton: putative glucose dehydrogenase B
Locus tag: MCCL_0360
Name: gfoI
Funciton: putative sugar isomerase
Locus tag: MCCL_0361
Name: mdxK
Funciton: Maltose/maltodextrin transport ATP-binding protein
Locus tag: MCCL_0362
Name: malA
Funciton: Alpha-glucosidase (EC 3.2.1.20)
mdxE-mdxF-mdxG-malR-MCCL_0357-gfoA-gfoB-gfoI-mdxK-malA -110 6.7 TTATGCAATCGTTTGCAAAA MCCL_0353
Staphylococcus aureus subsp. aureus N315
Position: -66
Score: 6.74219
Sequence: TTGTGCAAACGTTTTCACAA
Locus tag: SA0206
Name: mdxK
Funciton: Maltose/maltodextrin transport ATP-binding protein
Locus tag: SA0207
Name: mdxE
Funciton: Maltose/maltodextrin ABC transporter, substrate binding protein
Locus tag: SA0208
Name: mdxF
Funciton: Maltose/maltodextrin ABC transporter, permease protein
Locus tag: SA0209
Name: mdxG
Funciton: Maltose/maltodextrin ABC transporter, permease protein
Locus tag: SA0210
Name: gfoA
Funciton: putative glucose dehydrogenase A
Locus tag: SA0211
Name: gfoB
Funciton: putative glucose dehydrogenase B
Locus tag: SA0212
Name: gfoI
Funciton: putative sugar isomerase
mdxK-mdxE-mdxF-mdxG-gfoA-gfoB-gfoI -66 6.7 TTGTGCAAACGTTTTCACAA SA0206