Orthologous regulated operons containing malR gene
Regulog: | MalR - Staphylococcaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Maltose utilization; Maltodextrin utilization |
Effector: | Maltose |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Macrococcus caseolyticus JCSC5402 | ||||
Position: -110
Score: 6.66683 Sequence: TTATGCAATCGTTTGCAAAA
Locus tag: MCCL_0353
Name: mdxE Funciton: Maltose/maltodextrin ABC transporter, substrate binding protein
Locus tag: MCCL_0354
Name: mdxF Funciton: Maltose/maltodextrin ABC transporter, permease protein
Locus tag: MCCL_0355
Name: mdxG Funciton: Maltose/maltodextrin ABC transporter, permease protein
Locus tag: MCCL_0356
Name: malR Funciton: Maltose operon transcriptional repressor MalR, LacI family
Locus tag: MCCL_0357
Name: MCCL_0357 Funciton: trehalosemaltose utilization protein
Locus tag: MCCL_0358
Name: gfoA Funciton: putative glucose dehydrogenase A
Locus tag: MCCL_0359
Name: gfoB Funciton: putative glucose dehydrogenase B
Locus tag: MCCL_0360
Name: gfoI Funciton: putative sugar isomerase
Locus tag: MCCL_0361
Name: mdxK Funciton: Maltose/maltodextrin transport ATP-binding protein
Locus tag: MCCL_0362
Name: malA Funciton: Alpha-glucosidase (EC 3.2.1.20) |
||||
mdxE-mdxF-mdxG-malR-MCCL_0357-gfoA-gfoB-gfoI-mdxK-malA | -110 | 6.7 | TTATGCAATCGTTTGCAAAA | MCCL_0353 |
Staphylococcus aureus subsp. aureus N315 | ||||
Position: -112
Score: 6.90263 Sequence: TTATGCAATCGTTTGCACAA
Locus tag: SA1339
Name: malR Funciton: Maltose operon transcriptional repressor MalR, LacI family
Locus tag: SA1338
Name: malA Funciton: Alpha-glucosidase (EC 3.2.1.20) |
||||
malR-malA | -112 | 6.9 | TTATGCAATCGTTTGCACAA | SA1339 |
Staphylococcus haemolyticus JCSC1435 | ||||
Position: -228
Score: 6.55203 Sequence: TTATGCAAACGATTGCATTA
Locus tag: SH1407
Name: malR Funciton: Maltose operon transcriptional repressor MalR, LacI family
Locus tag: SH1408
Name: malA Funciton: Alpha-glucosidase (EC 3.2.1.20) |
||||
malR-malA | -228 | 6.6 | TTATGCAAACGATTGCATTA | SH1407 |
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | ||||
Position: -106
Score: 6.42784 Sequence: TCGCGCAAACGTTTGCACAA
Locus tag: SSP1245
Name: malR Funciton: Maltose operon transcriptional repressor MalR, LacI family
Locus tag: SSP1246
Name: malA Funciton: Alpha-glucosidase (EC 3.2.1.20) |
||||
malR-malA | -106 | 6.4 | TCGCGCAAACGTTTGCACAA | SSP1245 |