Orthologous regulated operons containing recA gene
| Regulog: | LexA - Staphylococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Macrococcus caseolyticus JCSC5402 | ||||
|
Position: -132
Score: 5.22781 Sequence: ATACAAACAGACGTTCGCAT
Locus tag: MCCL_0875
Name: recA Funciton: recombinase A |
||||
| recA | -132 | 5.2 | ATACAAACAGACGTTCGCAT | MCCL_0875 |
| Staphylococcus aureus subsp. aureus N315 | ||||
|
Position: -145
Score: 5.08341 Sequence: ATAAGCACGTTTGTTCGTTT
Position: -102
Score: 5.37383 Sequence: ATACGAACAAATATTCGCAA
Locus tag: SA1128
Name: recA Funciton: recombinase A |
||||
| recA | -145 | 5.1 | ATAAGCACGTTTGTTCGTTT | SA1128 |
| -102 | 5.4 | ATACGAACAAATATTCGCAA | ||
| Staphylococcus capitis SK14 | ||||
|
Position: -146
Score: 4.85405 Sequence: ATAAGTACGTTTGTTCGATT
Position: -103
Score: 5.07845 Sequence: ACACGAACAAATATTCGCAA
Locus tag: STACA0001_2334
Name: recA Funciton: recombinase A |
||||
| recA | -146 | 4.9 | ATAAGTACGTTTGTTCGATT | STACA0001_2334 |
| -103 | 5.1 | ACACGAACAAATATTCGCAA | ||
| Staphylococcus carnosus subsp. carnosus TM300 | ||||
|
Position: -102
Score: 4.98446 Sequence: AATCGAACAAACATTCGCAA
Locus tag: Sca_0926
Name: recA Funciton: recombinase A |
||||
| recA | -102 | 5 | AATCGAACAAACATTCGCAA | Sca_0926 |
| Staphylococcus epidermidis ATCC 12228 | ||||
|
Position: -145
Score: 5.08341 Sequence: ATAAGTACGTTTGTTCGTTT
Position: -102
Score: 5.37383 Sequence: ATACGAACAAATATTCGCAA
Locus tag: SE0963
Name: recA Funciton: recombinase A |
||||
| recA | -145 | 5.1 | ATAAGTACGTTTGTTCGTTT | SE0963 |
| -102 | 5.4 | ATACGAACAAATATTCGCAA | ||
| Staphylococcus haemolyticus JCSC1435 | ||||
|
Position: -105
Score: 5.21492 Sequence: AAGCGAACAAATATTCGCAA
Locus tag: SH1628
Name: recA Funciton: recombinase A |
||||
| recA | -105 | 5.2 | AAGCGAACAAATATTCGCAA | SH1628 |
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | ||||
|
Position: -104
Score: 5.06506 Sequence: TAGCGAACAAATATTCGCAA
Locus tag: SSP1480
Name: recA Funciton: recombinase A |
||||
| recA | -104 | 5.1 | TAGCGAACAAATATTCGCAA | SSP1480 |