Orthologous regulated operons containing cysI gene

Properties
Regulog:	CymR - Staphylococcaceae
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Cysteine metabolism
Effector:	O-acetyl-L-serine; CysK, cysteine synthetase
Phylum:	Firmicutes

Built upon 69 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Staphylococcus capitis SK14
Position: -246 Score: 4.71748 Sequence: TAAAGCATAGTATTCCGATAAGATATA Locus tag: STACA0001_1811 Name: cysJ Funciton: sulfite reductase [NADPH] flavoprotein, alpha-component Locus tag: STACA0001_1810 Name: cysI Funciton: sulfite reductase (NADPH) hemoprotein, beta-component Locus tag: STACA0001_1809 Name: cysG Funciton: uroporphyrin-III C-methyltransferase Locus tag: STACA0001_1808 Name: sirC Funciton: Precorrin-2 dehydrogenase Locus tag: STACA0001_1807 Name: ytnM Funciton: conserved membrane protein YtnM Locus tag: STACA0001_1806 Name: cysD Funciton: sulfate adenylyltransferase Locus tag: STACA0001_1805 Name: cysC Funciton: adenylylsulfate kinase
cysJ-cysI-cysG-sirC-ytnM-cysD-cysC	-246	4.7	TAAAGCATAGTATTCCGATAAGATATA	STACA0001_1811
Staphylococcus carnosus subsp. carnosus TM300
Position: -134 Score: 5.42667 Sequence: TAATTCTTAGTAAACCTATTGGAATTA Position: -52 Score: 5.94771 Sequence: TAATTCCTACTAAAAAACTAAGAATAA Locus tag: Sca_0059 Name: cysJ Funciton: sulfite reductase [NADPH] flavoprotein, alpha-component Locus tag: Sca_0060 Name: cysI Funciton: sulfite reductase (NADPH) hemoprotein, beta-component Locus tag: Sca_0061 Name: cysG Funciton: uroporphyrin-III C-methyltransferase
cysJ-cysI-cysG	-134	5.4	TAATTCTTAGTAAACCTATTGGAATTA	Sca_0059
	-52	5.9	TAATTCCTACTAAAAAACTAAGAATAA
Staphylococcus epidermidis ATCC 12228
Position: -273 Score: 4.71837 Sequence: CAAAACATAGTATTCCGATAAGAAATA Locus tag: SE2180 Name: cysJ Funciton: sulfite reductase [NADPH] flavoprotein, alpha-component Locus tag: SE2179 Name: cysI Funciton: sulfite reductase (NADPH) hemoprotein, beta-component Locus tag: SE2178 Name: cysG Funciton: uroporphyrin-III C-methyltransferase Locus tag: SE2177 Name: sirC Funciton: Precorrin-2 dehydrogenase Locus tag: SE2176 Name: ytnM Funciton: conserved membrane protein YtnM Locus tag: SE2175 Name: cysD Funciton: sulfate adenylyltransferase Locus tag: SE2174 Name: cysC Funciton: adenylylsulfate kinase
cysJ-cysI-cysG-sirC-ytnM-cysD-cysC	-273	4.7	CAAAACATAGTATTCCGATAAGAAATA	SE2180
Staphylococcus haemolyticus JCSC1435
Position: -152 Score: 4.51928 Sequence: TAAAACATAGTATTCTGATATGTTTTG Position: -68 Score: 5.56749 Sequence: TTATTCTGACAATTCTGATAGGTATTA Locus tag: SH0413 Name: cysH Funciton: phosphoadenosine phosphosulfate reductase Locus tag: SH0414 Name: cysJ Funciton: sulfite reductase [NADPH] flavoprotein, alpha-component Locus tag: SH0415 Name: cysI Funciton: sulfite reductase (NADPH) hemoprotein, beta-component Locus tag: SH0416 Name: cysG Funciton: uroporphyrin-III C-methyltransferase Locus tag: SH0417 Name: sirC Funciton: Precorrin-2 dehydrogenase Locus tag: SH0418 Name: ytnM Funciton: conserved membrane protein YtnM
cysH-cysJ-cysI-cysG-sirC-ytnM	-152	4.5	TAAAACATAGTATTCTGATATGTTTTG	SH0413
	-68	5.6	TTATTCTGACAATTCTGATAGGTATTA
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Position: -152 Score: 4.52675 Sequence: AATAACCTAGTATTCGTATCGGAAATA Position: -58 Score: 4.58672 Sequence: TTAAACCTATTTAGACAATAATTATAA Locus tag: SSP2408 Name: cysJ Funciton: sulfite reductase [NADPH] flavoprotein, alpha-component Locus tag: SSP2407 Name: cysI Funciton: sulfite reductase (NADPH) hemoprotein, beta-component Locus tag: SSP2406 Name: cysG Funciton: uroporphyrin-III C-methyltransferase Locus tag: SSP2405 Name: SSP2405 Funciton: sirohydrochlorin ferrochelatase Locus tag: SSP2404 Name: sirC Funciton: Precorrin-2 dehydrogenase Locus tag: SSP2403 Name: ytnM Funciton: conserved membrane protein YtnM Locus tag: SSP2402 Name: cysD Funciton: sulfate adenylyltransferase Locus tag: SSP2401 Name: cysC Funciton: adenylylsulfate kinase
cysJ-cysI-cysG-SSP2405-sirC-ytnM-cysD-cysC	-152	4.5	AATAACCTAGTATTCGTATCGGAAATA	SSP2408
	-58	4.6	TTAAACCTATTTAGACAATAATTATAA