Orthologous regulated operons containing hisR gene
| Regulog: | HisR - Staphylococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | TrpR |
| Regulation mode: | repressor |
| Biological process: | Histidine biosynthesis |
| Effector: | Histidine |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Staphylococcus aureus subsp. aureus N315 | ||||
|
Position: -62
Score: 5.16946 Sequence: CACTTTAATAGATTAATGCG
Locus tag: SA1723
Name: hisR Funciton: Predicted histidine repressor, TrpR family |
||||
| hisR | -62 | 5.2 | CACTTTAATAGATTAATGCG | SA1723 |
| Staphylococcus capitis SK14 | ||||
|
Position: -60
Score: 5.07424 Sequence: CACTTTAACTAATTAGTACG
Locus tag: STACA0001_1960
Name: hisR Funciton: Predicted histidine repressor, TrpR family |
||||
| hisR | -60 | 5.1 | CACTTTAACTAATTAGTACG | STACA0001_1960 |
| Staphylococcus carnosus subsp. carnosus TM300 | ||||
|
Position: -60
Score: 5.08992 Sequence: CACTTTAACGTATTAGTACG
Locus tag: Sca_1481
Name: hisR Funciton: Predicted histidine repressor, TrpR family |
||||
| hisR | -60 | 5.1 | CACTTTAACGTATTAGTACG | Sca_1481 |
| Staphylococcus epidermidis ATCC 12228 | ||||
|
Position: -60
Score: 5.03122 Sequence: CACTTTAACGAATTAGTAAG
Locus tag: SE1592
Name: hisR Funciton: Predicted histidine repressor, TrpR family |
||||
| hisR | -60 | 5 | CACTTTAACGAATTAGTAAG | SE1592 |
| Staphylococcus haemolyticus JCSC1435 | ||||
|
Position: -65
Score: 5.43956 Sequence: CACTTTAACTATTTAATGCG
Locus tag: SH1044
Name: hisR Funciton: Predicted histidine repressor, TrpR family |
||||
| hisR | -65 | 5.4 | CACTTTAACTATTTAATGCG | SH1044 |
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | ||||
|
Position: -61
Score: 5.06836 Sequence: CACTTTAATGTACTAATACG
Locus tag: SSP0883
Name: hisR Funciton: Predicted histidine repressor, TrpR family |
||||
| hisR | -61 | 5.1 | CACTTTAATGTACTAATACG | SSP0883 |