Orthologous regulated operons containing yxeR gene
| Regulog: | YxeR - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Antibiotic resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Lactobacillus acidophilus NCFM | ||||
|
Position: -81
Score: 3.62285 Sequence: TTATTGACAACTCGTCACAAT
Locus tag: LBA1840
Name: yxeR Funciton: Predicted antibiotic resistance transcriptional reguator, TetR family
Locus tag: LBA1839
Name: yxeA Funciton: Predicted antimicrobial peptide transporter, permease protein
Locus tag: LBA1838
Name: yxeB Funciton: Predicted antimicrobial peptide transporter, ATP-binding protein |
||||
| yxeR-yxeA-yxeB | -81 | 3.6 | TTATTGACAACTCGTCACAAT | LBA1840 |
| Lactobacillus brevis ATCC 367 | ||||
|
Position: -90
Score: 4.28818 Sequence: AAGTTGACACGGTGTCACTCA
Position: -46
Score: 5.08897 Sequence: TAAGTGACGCCGTGTCACTTA
Locus tag: LVIS_2199
Name: yxeR Funciton: Predicted antibiotic resistance transcriptional reguator, TetR family
Locus tag: LVIS_2198
Name: yxeA Funciton: Predicted antimicrobial peptide transporter, permease protein
Locus tag: LVIS_2197
Name: yxeB Funciton: Predicted antimicrobial peptide transporter, ATP-binding protein |
||||
| yxeR-yxeA-yxeB | -90 | 4.3 | AAGTTGACACGGTGTCACTCA | LVIS_2199 |
| -46 | 5.1 | TAAGTGACGCCGTGTCACTTA | ||
| Lactobacillus casei ATCC 334 | ||||
|
Position: -77
Score: 4.16518 Sequence: ATGTTGACACGGTGTCACTTT
Position: -33
Score: 4.68857 Sequence: TTAGTGACACCGTGTCACCAC
Locus tag: LSEI_0394
Name: yxeR Funciton: Predicted antibiotic resistance transcriptional reguator, TetR family
Locus tag: LSEI_0395
Name: yxeA Funciton: Predicted antimicrobial peptide transporter, permease protein
Locus tag: LSEI_0396
Name: yxeB Funciton: Predicted antimicrobial peptide transporter, ATP-binding protein |
||||
| yxeR-yxeA-yxeB | -77 | 4.2 | ATGTTGACACGGTGTCACTTT | LSEI_0394 |
| -33 | 4.7 | TTAGTGACACCGTGTCACCAC | ||
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | ||||
|
Position: -73
Score: 3.11839 Sequence: GTGTTGGAACGGTGTCACTTT
Position: -29
Score: 3.48738 Sequence: AGGGTGACACGGTGTCACGGA
Locus tag: LBUL_1914
Name: yxeR Funciton: Predicted antibiotic resistance transcriptional reguator, TetR family
Locus tag: LBUL_1913
Name: yxeA Funciton: Predicted antimicrobial peptide transporter, permease protein
Locus tag: LBUL_1912
Name: yxeB Funciton: Predicted antimicrobial peptide transporter, ATP-binding protein |
||||
| yxeR-yxeA-yxeB | -73 | 3.1 | GTGTTGGAACGGTGTCACTTT | LBUL_1914 |
| -29 | 3.5 | AGGGTGACACGGTGTCACGGA | ||
| Lactobacillus fermentum IFO 3956 | ||||
|
Position: -83
Score: 3.76478 Sequence: AAGTTGACACGGTGTCACCTC
Position: -42
Score: 4.16518 Sequence: CGAGTGACACGGTGTCACTAT
Locus tag: LAF_1826
Name: yxeR Funciton: Predicted antibiotic resistance transcriptional reguator, TetR family
Locus tag: LAF_1825
Name: yxeA Funciton: Predicted antimicrobial peptide transporter, permease protein
Locus tag: LAF_1824
Name: yxeB Funciton: Predicted antimicrobial peptide transporter, ATP-binding protein |
||||
| yxeR-yxeA-yxeB | -83 | 3.8 | AAGTTGACACGGTGTCACCTC | LAF_1826 |
| -42 | 4.2 | CGAGTGACACGGTGTCACTAT | ||
| Lactobacillus helveticus DPC 4571 | ||||
|
Position: -80
Score: 4.49461 Sequence: GTATTGACAATGCGTCACAAA
Locus tag: lhv_1880
Name: yxeR Funciton: Predicted antibiotic resistance transcriptional reguator, TetR family
Locus tag: lhv_1879
Name: yxeA Funciton: Predicted antimicrobial peptide transporter, permease protein
Locus tag: lhv_1878
Name: yxeB Funciton: Predicted antimicrobial peptide transporter, ATP-binding protein |
||||
| yxeR-yxeA-yxeB | -80 | 4.5 | GTATTGACAATGCGTCACAAA | lhv_1880 |
| Lactobacillus johnsonii NCC 533 | ||||
|
Position: -75
Score: 4.16518 Sequence: ATGTTGACACGGTGTCACTTT
Position: -31
Score: 4.96597 Sequence: AAAGTGACACAGTGTCACAAG
Locus tag: LJ0539
Name: yxeR Funciton: Predicted antibiotic resistance transcriptional reguator, TetR family
Locus tag: LJ0540
Name: yxeA Funciton: Predicted antimicrobial peptide transporter, permease protein
Locus tag: LJ0541
Name: yxeB Funciton: Predicted antimicrobial peptide transporter, ATP-binding protein |
||||
| yxeR-yxeA-yxeB | -75 | 4.2 | ATGTTGACACGGTGTCACTTT | LJ0539 |
| -31 | 5 | AAAGTGACACAGTGTCACAAG | ||
| Lactobacillus reuteri JCM 1112 | ||||
|
Position: -83
Score: 4.50545 Sequence: TGATTGACATGGTGTCACTTT
Position: -38
Score: 3.36439 Sequence: ACGGTGACACGGTGTCACGAT
Locus tag: LAR_1741
Name: yxeR Funciton: Predicted antibiotic resistance transcriptional reguator, TetR family
Locus tag: LAR_1740
Name: yxeA Funciton: Predicted antimicrobial peptide transporter, permease protein
Locus tag: LAR_1739
Name: yxeB Funciton: Predicted antimicrobial peptide transporter, ATP-binding protein |
||||
| yxeR-yxeA-yxeB | -83 | 4.5 | TGATTGACATGGTGTCACTTT | LAR_1741 |
| -38 | 3.4 | ACGGTGACACGGTGTCACGAT | ||
| Lactobacillus rhamnosus GG | ||||
|
Position: -122
Score: 4.16518 Sequence: AAGTTGACACCGTGTCACTAT
Position: -78
Score: 3.36439 Sequence: ACGGTGACACGGTGTCACCAT
Locus tag: LGG_00488
Name: yxeR Funciton: Predicted antibiotic resistance transcriptional reguator, TetR family
Locus tag: LGG_00489
Name: yxeA Funciton: Predicted antimicrobial peptide transporter, permease protein
Locus tag: LGG_00490
Name: yxeB Funciton: Predicted antimicrobial peptide transporter, ATP-binding protein |
||||
| yxeR-yxeA-yxeB | -122 | 4.2 | AAGTTGACACCGTGTCACTAT | LGG_00488 |
| -78 | 3.4 | ACGGTGACACGGTGTCACCAT | ||
| Oenococcus oeni PSU-1 | ||||
|
Position: -72
Score: 3.64179 Sequence: AAATTGACGCCGTGTCACCAT
Position: -35
Score: 4.90585 Sequence: TTAGTGACGTGGTGTCACTTA
Locus tag: OEOE_0733
Name: yxeR Funciton: Predicted antibiotic resistance transcriptional reguator, TetR family
Locus tag: OEOE_0734
Name: yxeA Funciton: Predicted antimicrobial peptide transporter, permease protein
Locus tag: OEOE_0735
Name: yxeB Funciton: Predicted antimicrobial peptide transporter, ATP-binding protein |
||||
| yxeR-yxeA-yxeB | -72 | 3.6 | AAATTGACGCCGTGTCACCAT | OEOE_0733 |
| -35 | 4.9 | TTAGTGACGTGGTGTCACTTA | ||
| Pediococcus pentosaceus ATCC 25745 | ||||
|
Position: -76
Score: 4.56558 Sequence: ATTTTGACACGGTGTCACTTT
Position: -41
Score: 5.21197 Sequence: TTGTTGACACGGTGTCATTTT
Locus tag: PEPE_0017
Name: yxeR Funciton: Predicted antibiotic resistance transcriptional reguator, TetR family
Locus tag: PEPE_0018
Name: yxeA Funciton: Predicted antimicrobial peptide transporter, permease protein
Locus tag: PEPE_0019
Name: yxeB Funciton: Predicted antimicrobial peptide transporter, ATP-binding protein |
||||
| yxeR-yxeA-yxeB | -76 | 4.6 | ATTTTGACACGGTGTCACTTT | PEPE_0017 |
| -41 | 5.2 | TTGTTGACACGGTGTCATTTT | ||