Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing LAF_1465 gene

Properties
Regulog: FlpA - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Heavy metal resistance
Effector: Oxygen
Phylum: Firmicutes
Built upon 32 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactobacillus fermentum IFO 3956
Position: -91
Score: 4.76427
Sequence: AAGTTGATAGAAAACAATTT
Locus tag: LAF_1466
Name: copZ
Funciton: Copper chaperone
Locus tag: LAF_1465
Name: LAF_1465
Funciton: Hypothetical protein
Locus tag: LAF_1464
Name: flpA
Funciton: Heavy metal resistance transcriptional regulator FlpA, Crp family
copZ-LAF_1465-flpA -91 4.8 AAGTTGATAGAAAACAATTT LAF_1466