Orthologous regulated operons containing pgmX gene

Properties
Regulog:	UxuR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Glucuronate utilization; Galacturonate utilization
Effector:
Phylum:	Firmicutes

Built upon 3 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Lactobacillus brevis ATCC 367
Position: -86 Score: 6.5775 Sequence: AATACTGATATATAAGTTAT Locus tag: LVIS_0139 Name: uxuB Funciton: D-mannonate oxidoreductase (EC 1.1.1.57) Locus tag: LVIS_0140 Name: yqhA Funciton: Predicted aldose epimerase Locus tag: LVIS_0141 Name: pgmX Funciton: Predicted phosphoglycerate mutase Locus tag: LVIS_0142 Name: pgdH Funciton: Predicted 3-phosphoglycerate dehydrogenase
uxuB-yqhA-pgmX-pgdH	-86	6.6	AATACTGATATATAAGTTAT	LVIS_0139

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --