Orthologous regulated operons containing uidB gene
| Regulog: | UxuR - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Glucuronate utilization; Galacturonate utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Lactobacillus brevis ATCC 367 | ||||
|
Position: -119
Score: 6.71987 Sequence: ATAGCTTATATATCAGTTTT
Locus tag: LVIS_0136
Name: uidB Funciton: Predicted oligogalacturonide transporter
Locus tag: LVIS_0135
Name: uxaC Funciton: Uronate isomerase (EC 5.3.1.12) |
||||
| uidB-uxaC | -119 | 6.7 | ATAGCTTATATATCAGTTTT | LVIS_0136 |