Orthologous regulated operons containing lp_3218 gene
| Regulog: | YwzG - Lactobacillaceae |
| Regulator type: | Transcription factor |
| Regulator family: | PadR |
| Regulation mode: | repressor |
| Biological process: | Transport |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Lactobacillus brevis ATCC 367 | ||||
|
Position: -36
Score: 7.05067 Sequence: ATATTATACGTCGTATAGTAT
Locus tag: LVIS_0242
Name: ywzG Funciton: Predicted transcriptional regulator, PadR family
Locus tag: LVIS_0243
Name: lp_3217 Funciton: Predicted integral membrane protein
Locus tag: LVIS_0244
Name: lp_3218 Funciton: Conserved hypothetical protein |
||||
| ywzG-lp_3217-lp_3218 | -36 | 7.1 | ATATTATACGTCGTATAGTAT | LVIS_0242 |
| Lactobacillus plantarum WCFS1 | ||||
|
Position: -37
Score: 7.05067 Sequence: ATACTATACGACGTATAATAT
Locus tag: lp_3216
Name: ywzG Funciton: Predicted transcriptional regulator, PadR family
Locus tag: lp_3217
Name: lp_3217 Funciton: Predicted integral membrane protein
Locus tag: lp_3218
Name: lp_3218 Funciton: Conserved hypothetical protein |
||||
| ywzG-lp_3217-lp_3218 | -37 | 7.1 | ATACTATACGACGTATAATAT | lp_3216 |
| Lactobacillus reuteri JCM 1112 | ||||
|
Position: -44
Score: 7.20334 Sequence: ATATTATATGACATATAATAT
Locus tag: LAR_0307
Name: ywzG Funciton: Predicted transcriptional regulator, PadR family
Locus tag: LAR_0308
Name: lp_3217 Funciton: Predicted integral membrane protein
Locus tag: LAR_0309
Name: lp_3218 Funciton: Conserved hypothetical protein |
||||
| ywzG-lp_3217-lp_3218 | -44 | 7.2 | ATATTATATGACATATAATAT | LAR_0307 |
| Lactobacillus salivarius subsp. salivarius UCC118 | ||||
|
Position: -59
Score: 6.88491 Sequence: ATATTATATGATATATAATAT
Locus tag: LSL_0105
Name: ywzG Funciton: Predicted transcriptional regulator, PadR family
Locus tag: LSL_0106
Name: lp_3217 Funciton: Predicted integral membrane protein
Locus tag: LSL_0107
Name: lp_3218 Funciton: Conserved hypothetical protein
Locus tag: LSL_0108
Name: COG1983 Funciton: Putative stress-responsive transcriptional regulator |
||||
| ywzG-lp_3217-lp_3218-COG1983 | -59 | 6.9 | ATATTATATGATATATAATAT | LSL_0105 |
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | ||||
|
Position: -35
Score: 7.10156 Sequence: ATATTATATGTCGTATAGTAT
Locus tag: LEUM_2026
Name: ywzG Funciton: Predicted transcriptional regulator, PadR family
Locus tag: LEUM_2025
Name: lp_3217 Funciton: Predicted integral membrane protein
Locus tag: LEUM_2024
Name: lp_3218 Funciton: Conserved hypothetical protein |
||||
| ywzG-lp_3217-lp_3218 | -35 | 7.1 | ATATTATATGTCGTATAGTAT | LEUM_2026 |
| Pediococcus pentosaceus ATCC 25745 | ||||
|
Position: -36
Score: 6.78313 Sequence: ATACTATATGAGATATAGTAT
Locus tag: PEPE_1823
Name: ywzG Funciton: Predicted transcriptional regulator, PadR family
Locus tag: PEPE_1824
Name: lp_3217 Funciton: Predicted integral membrane protein
Locus tag: PEPE_1825
Name: lp_3218 Funciton: Conserved hypothetical protein |
||||
| ywzG-lp_3217-lp_3218 | -36 | 6.8 | ATACTATATGAGATATAGTAT | PEPE_1823 |