Orthologous regulated operons containing ywzG gene

Properties
Regulog:	YwzG - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	PadR
Regulation mode:	repressor
Biological process:	Transport
Effector:
Phylum:	Firmicutes

Built upon 6 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Lactobacillus brevis ATCC 367
Position: -36 Score: 7.05067 Sequence: ATATTATACGTCGTATAGTAT Locus tag: LVIS_0242 Name: ywzG Funciton: Predicted transcriptional regulator, PadR family Locus tag: LVIS_0243 Name: lp_3217 Funciton: Predicted integral membrane protein Locus tag: LVIS_0244 Name: lp_3218 Funciton: Conserved hypothetical protein
ywzG-lp_3217-lp_3218	-36	7.1	ATATTATACGTCGTATAGTAT	LVIS_0242
Lactobacillus plantarum WCFS1
Position: -37 Score: 7.05067 Sequence: ATACTATACGACGTATAATAT Locus tag: lp_3216 Name: ywzG Funciton: Predicted transcriptional regulator, PadR family Locus tag: lp_3217 Name: lp_3217 Funciton: Predicted integral membrane protein Locus tag: lp_3218 Name: lp_3218 Funciton: Conserved hypothetical protein
ywzG-lp_3217-lp_3218	-37	7.1	ATACTATACGACGTATAATAT	lp_3216
Lactobacillus reuteri JCM 1112
Position: -44 Score: 7.20334 Sequence: ATATTATATGACATATAATAT Locus tag: LAR_0307 Name: ywzG Funciton: Predicted transcriptional regulator, PadR family Locus tag: LAR_0308 Name: lp_3217 Funciton: Predicted integral membrane protein Locus tag: LAR_0309 Name: lp_3218 Funciton: Conserved hypothetical protein
ywzG-lp_3217-lp_3218	-44	7.2	ATATTATATGACATATAATAT	LAR_0307
Lactobacillus salivarius subsp. salivarius UCC118
Position: -59 Score: 6.88491 Sequence: ATATTATATGATATATAATAT Locus tag: LSL_0105 Name: ywzG Funciton: Predicted transcriptional regulator, PadR family Locus tag: LSL_0106 Name: lp_3217 Funciton: Predicted integral membrane protein Locus tag: LSL_0107 Name: lp_3218 Funciton: Conserved hypothetical protein Locus tag: LSL_0108 Name: COG1983 Funciton: Putative stress-responsive transcriptional regulator
ywzG-lp_3217-lp_3218-COG1983	-59	6.9	ATATTATATGATATATAATAT	LSL_0105
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Position: -35 Score: 7.10156 Sequence: ATATTATATGTCGTATAGTAT Locus tag: LEUM_2026 Name: ywzG Funciton: Predicted transcriptional regulator, PadR family Locus tag: LEUM_2025 Name: lp_3217 Funciton: Predicted integral membrane protein Locus tag: LEUM_2024 Name: lp_3218 Funciton: Conserved hypothetical protein
ywzG-lp_3217-lp_3218	-35	7.1	ATATTATATGTCGTATAGTAT	LEUM_2026
Pediococcus pentosaceus ATCC 25745
Position: -36 Score: 6.78313 Sequence: ATACTATATGAGATATAGTAT Locus tag: PEPE_1823 Name: ywzG Funciton: Predicted transcriptional regulator, PadR family Locus tag: PEPE_1824 Name: lp_3217 Funciton: Predicted integral membrane protein Locus tag: PEPE_1825 Name: lp_3218 Funciton: Conserved hypothetical protein
ywzG-lp_3217-lp_3218	-36	6.8	ATACTATATGAGATATAGTAT	PEPE_1823