Orthologous regulated operons containing nrfH gene

Properties
Regulog:	NrfR - Bacteroidaceae
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator
Biological process:	Nitrate and nitrite respiration
Effector:	Nitrite
Phylum:	Bacteroidetes

Built upon 6 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bacteroides cellulosilyticus DSM 14838
Position: -65 Score: 6.58022 Sequence: GATGTAATCATTATTACACT Locus tag: BACCELL_02840 Name: nrfH Funciton: Cytochrome c nitrite reductase, small subunit NrfH Locus tag: BACCELL_02841 Name: nrfA Funciton: Cytochrome c552 precursor (EC 1.7.2.2) Locus tag: BACCELL_02842 Name: nrfI Funciton: Cytochrome c biogenesis protein
nrfH-nrfA-nrfI	-65	6.6	GATGTAATCATTATTACACT	BACCELL_02840
Bacteroides fragilis NCTC 9343
Position: -73 Score: 6.13525 Sequence: AATGTAATCTGGATTACATC Locus tag: BF0360 Name: nrfH Funciton: Cytochrome c nitrite reductase, small subunit NrfH Locus tag: BF0361 Name: nrfA Funciton: Cytochrome c552 precursor (EC 1.7.2.2) Locus tag: BF0362 Name: nrfI Funciton: Cytochrome c biogenesis protein Locus tag: BF0363 Name: nrfE Funciton: Cytochrome c biogenesis protein Locus tag: BF0364 Name: nrfP Funciton: Predicted porin, associated with nitrate respiration Locus tag: BF0365 Name: nrfR Funciton: Predicted transcriptional regulator of nitrite reductase, Crp family
nrfH-nrfA-nrfI-nrfE-nrfP-nrfR	-73	6.1	AATGTAATCTGGATTACATC	BF0360
Bacteroides ovatus ATCC 8483
Position: -65 Score: 6.42757 Sequence: GGTGTAATAGATATTACACC Locus tag: BACOVA_00831 Name: nrfH Funciton: Cytochrome c nitrite reductase, small subunit NrfH Locus tag: BACOVA_00830 Name: nrfA Funciton: Cytochrome c552 precursor (EC 1.7.2.2) Locus tag: BACOVA_00829 Name: nrfI Funciton: Cytochrome c biogenesis protein Locus tag: BACOVA_00828 Name: nrfE Funciton: Cytochrome c biogenesis protein Locus tag: BACOVA_00827 Name: nrfP Funciton: Predicted porin, associated with nitrate respiration
nrfH-nrfA-nrfI-nrfE-nrfP	-65	6.4	GGTGTAATAGATATTACACC	BACOVA_00831
Bacteroides plebeius DSM 17135
Position: 27 Score: 6.01401 Sequence: GGTGTCATATTTATTACACC Locus tag: BACPLE_01440 Name: nrfH Funciton: Cytochrome c nitrite reductase, small subunit NrfH Locus tag: BACPLE_01441 Name: nrfA Funciton: Cytochrome c552 precursor (EC 1.7.2.2) Locus tag: BACPLE_01442 Name: nrfI Funciton: Cytochrome c biogenesis protein Locus tag: BACPLE_01443 Name: nrfE Funciton: Cytochrome c biogenesis protein Locus tag: BACPLE_01444 Name: nrfP Funciton: Predicted porin, associated with nitrate respiration
nrfH-nrfA-nrfI-nrfE-nrfP	27	6	GGTGTCATATTTATTACACC	BACPLE_01440
Bacteroides thetaiotaomicron VPI-5482
Position: -66 Score: 6.57031 Sequence: GGTGTAATAGTTATTACACC Locus tag: BT1418 Name: nrfH Funciton: Cytochrome c nitrite reductase, small subunit NrfH Locus tag: BT1417 Name: nrfA Funciton: Cytochrome c552 precursor (EC 1.7.2.2) Locus tag: BT1416 Name: nrfI Funciton: Cytochrome c biogenesis protein Locus tag: BT1415 Name: nrfE Funciton: Cytochrome c biogenesis protein Locus tag: BT1414 Name: nrfP Funciton: Predicted porin, associated with nitrate respiration
nrfH-nrfA-nrfI-nrfE-nrfP	-66	6.6	GGTGTAATAGTTATTACACC	BT1418
Bacteroides uniformis ATCC 8492
Position: -64 Score: 6.5138 Sequence: AATGTAATCATGATTACACT Locus tag: BACUNI_04432 Name: nrfH Funciton: Cytochrome c nitrite reductase, small subunit NrfH Locus tag: BACUNI_04431 Name: nrfA Funciton: Cytochrome c552 precursor (EC 1.7.2.2) Locus tag: BACUNI_04430 Name: nrfI Funciton: Cytochrome c biogenesis protein Locus tag: BACUNI_04429 Name: nrfE Funciton: Cytochrome c biogenesis protein Locus tag: BACUNI_04428 Name: nrfP Funciton: Predicted porin, associated with nitrate respiration
nrfH-nrfA-nrfI-nrfE-nrfP	-64	6.5	AATGTAATCATGATTACACT	BACUNI_04432