Orthologous regulated operons containing nrfH gene
| Regulog: | NrfR - Bacteroidaceae |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | activator |
| Biological process: | Nitrate and nitrite respiration |
| Effector: | Nitrite |
| Phylum: | Bacteroidetes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacteroides cellulosilyticus DSM 14838 | ||||
|
Position: -65
Score: 6.58022 Sequence: GATGTAATCATTATTACACT
Locus tag: BACCELL_02840
Name: nrfH Funciton: Cytochrome c nitrite reductase, small subunit NrfH
Locus tag: BACCELL_02841
Name: nrfA Funciton: Cytochrome c552 precursor (EC 1.7.2.2)
Locus tag: BACCELL_02842
Name: nrfI Funciton: Cytochrome c biogenesis protein |
||||
| nrfH-nrfA-nrfI | -65 | 6.6 | GATGTAATCATTATTACACT | BACCELL_02840 |
| Bacteroides fragilis NCTC 9343 | ||||
|
Position: -73
Score: 6.13525 Sequence: AATGTAATCTGGATTACATC
Locus tag: BF0360
Name: nrfH Funciton: Cytochrome c nitrite reductase, small subunit NrfH
Locus tag: BF0361
Name: nrfA Funciton: Cytochrome c552 precursor (EC 1.7.2.2)
Locus tag: BF0362
Name: nrfI Funciton: Cytochrome c biogenesis protein
Locus tag: BF0363
Name: nrfE Funciton: Cytochrome c biogenesis protein
Locus tag: BF0364
Name: nrfP Funciton: Predicted porin, associated with nitrate respiration
Locus tag: BF0365
Name: nrfR Funciton: Predicted transcriptional regulator of nitrite reductase, Crp family |
||||
| nrfH-nrfA-nrfI-nrfE-nrfP-nrfR | -73 | 6.1 | AATGTAATCTGGATTACATC | BF0360 |
| Bacteroides ovatus ATCC 8483 | ||||
|
Position: -65
Score: 6.42757 Sequence: GGTGTAATAGATATTACACC
Locus tag: BACOVA_00831
Name: nrfH Funciton: Cytochrome c nitrite reductase, small subunit NrfH
Locus tag: BACOVA_00830
Name: nrfA Funciton: Cytochrome c552 precursor (EC 1.7.2.2)
Locus tag: BACOVA_00829
Name: nrfI Funciton: Cytochrome c biogenesis protein
Locus tag: BACOVA_00828
Name: nrfE Funciton: Cytochrome c biogenesis protein
Locus tag: BACOVA_00827
Name: nrfP Funciton: Predicted porin, associated with nitrate respiration |
||||
| nrfH-nrfA-nrfI-nrfE-nrfP | -65 | 6.4 | GGTGTAATAGATATTACACC | BACOVA_00831 |
| Bacteroides plebeius DSM 17135 | ||||
|
Position: 27
Score: 6.01401 Sequence: GGTGTCATATTTATTACACC
Locus tag: BACPLE_01440
Name: nrfH Funciton: Cytochrome c nitrite reductase, small subunit NrfH
Locus tag: BACPLE_01441
Name: nrfA Funciton: Cytochrome c552 precursor (EC 1.7.2.2)
Locus tag: BACPLE_01442
Name: nrfI Funciton: Cytochrome c biogenesis protein
Locus tag: BACPLE_01443
Name: nrfE Funciton: Cytochrome c biogenesis protein
Locus tag: BACPLE_01444
Name: nrfP Funciton: Predicted porin, associated with nitrate respiration |
||||
| nrfH-nrfA-nrfI-nrfE-nrfP | 27 | 6 | GGTGTCATATTTATTACACC | BACPLE_01440 |
| Bacteroides thetaiotaomicron VPI-5482 | ||||
|
Position: -66
Score: 6.57031 Sequence: GGTGTAATAGTTATTACACC
Locus tag: BT1418
Name: nrfH Funciton: Cytochrome c nitrite reductase, small subunit NrfH
Locus tag: BT1417
Name: nrfA Funciton: Cytochrome c552 precursor (EC 1.7.2.2)
Locus tag: BT1416
Name: nrfI Funciton: Cytochrome c biogenesis protein
Locus tag: BT1415
Name: nrfE Funciton: Cytochrome c biogenesis protein
Locus tag: BT1414
Name: nrfP Funciton: Predicted porin, associated with nitrate respiration |
||||
| nrfH-nrfA-nrfI-nrfE-nrfP | -66 | 6.6 | GGTGTAATAGTTATTACACC | BT1418 |
| Bacteroides uniformis ATCC 8492 | ||||
|
Position: -64
Score: 6.5138 Sequence: AATGTAATCATGATTACACT
Locus tag: BACUNI_04432
Name: nrfH Funciton: Cytochrome c nitrite reductase, small subunit NrfH
Locus tag: BACUNI_04431
Name: nrfA Funciton: Cytochrome c552 precursor (EC 1.7.2.2)
Locus tag: BACUNI_04430
Name: nrfI Funciton: Cytochrome c biogenesis protein
Locus tag: BACUNI_04429
Name: nrfE Funciton: Cytochrome c biogenesis protein
Locus tag: BACUNI_04428
Name: nrfP Funciton: Predicted porin, associated with nitrate respiration |
||||
| nrfH-nrfA-nrfI-nrfE-nrfP | -64 | 6.5 | AATGTAATCATGATTACACT | BACUNI_04432 |