Orthologous regulated operons containing LEUM_0052 gene

Properties
Regulog:	YtrA - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Hypothetical ABC transporter
Effector:
Phylum:	Firmicutes

Built upon 8 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Position: -123 Score: 6.62508 Sequence: GTGTACTGTGTATTATAGTACAC Locus tag: LEUM_0050 Name: ytrA Funciton: Predicted transcriptional regulator, GntR family Locus tag: LEUM_0051 Name: ytrB Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: LEUM_0052 Name: LEUM_0052 Funciton: Hypothetical protein Locus tag: LEUM_0053 Name: ytrB Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: LEUM_0054 Name: OEOE_1804 Funciton: Predicted ABC transporter, permease protein
ytrA-ytrB-LEUM_0052-ytrB-OEOE_1804	-123	6.6	GTGTACTGTGTATTATAGTACAC	LEUM_0050

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --