Orthologous regulated operons containing lp_0327 gene

Properties
Regulog:	YtrA - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Hypothetical ABC transporter
Effector:
Phylum:	Firmicutes

Built upon 8 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Lactobacillus brevis ATCC 367
Position: -60 Score: 6.74141 Sequence: GTGTACTAGGTATAATAGTACAG Locus tag: LVIS_0408 Name: ytrA Funciton: Predicted transcriptional regulator, GntR family Locus tag: LVIS_0409 Name: ytrB Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: LVIS_0410 Name: lp_0327 Funciton: Predicted ABC transporter, permease protein
ytrA-ytrB-lp_0327	-60	6.7	GTGTACTAGGTATAATAGTACAG	LVIS_0408
Lactobacillus rhamnosus GG
Position: -46 Score: 6.6648 Sequence: GTGTACTGCGTATAATAGTACAC Locus tag: LGG_02246 Name: ytrA Funciton: Predicted transcriptional regulator, GntR family Locus tag: LGG_02245 Name: ytrB Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: LGG_02244 Name: lp_0327 Funciton: Predicted ABC transporter, permease protein
ytrA-ytrB-lp_0327	-46	6.7	GTGTACTGCGTATAATAGTACAC	LGG_02246
Lactobacillus sakei subsp. sakei 23K
Position: -61 Score: 6.78114 Sequence: GTGTACTACGTATAATAGTACAG Locus tag: LSA1419 Name: ytrA Funciton: Predicted transcriptional regulator, GntR family Locus tag: LSA1418 Name: ytrB Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: LSA1417 Name: ytrB Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: LSA1416 Name: lp_0327 Funciton: Predicted ABC transporter, permease protein
ytrA-ytrB-ytrB-lp_0327	-61	6.8	GTGTACTACGTATAATAGTACAG	LSA1419

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --