Orthologous regulated operons containing lp_2741 gene

Properties
Regulog:	Lp_2742 - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug efflux; Multidrug resistance
Effector:
Phylum:	Firmicutes

Built upon 8 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Lactobacillus plantarum WCFS1
Position: -59 Score: 6.83482 Sequence: TTAGTTACATAAGTAATTAA Locus tag: lp_2739 Name: lp_2739 Funciton: Predicted antimicrobial peptide ABC transporter, ATP-binding protein Locus tag: lp_2740 Name: lp_2740 Funciton: Predicted antimicrobial peptide ABC transporter, permease protein Locus tag: lp_2741 Name: lp_2741 Funciton: Predicted integral membrane protein Locus tag: lp_2742 Name: lp_2742 Funciton: Transcriptional regulator, GntR family Locus tag: lp_2743 Name: lp_2743 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: lp_2744 Name: lp_2744 Funciton: ABC-type multidrug transport system, permease component
lp_2739-lp_2740-lp_2741-lp_2742-lp_2743-lp_2744	-59	6.8	TTAGTTACATAAGTAATTAA	lp_2739

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --