Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing all3515 gene

Properties
Regulog: Zur - Cyanobacteria
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Cyanobacteria
Built upon 84 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Nostoc sp. PCC 7120
Position: -52
Score: 5.42815
Sequence: CTGATTATGATAATCATTATCGG
Locus tag: all3515
Name: all3515
Funciton: Putative outer membrane protein
all3515 -52 5.4 CTGATTATGATAATCATTATCGG all3515
© 2009-2020 RegPrecise