Orthologous regulated operons containing alr4032 gene
Regulog: | Zur - Cyanobacteria |
Regulator type: | Transcription factor |
Regulator family: | FUR |
Regulation mode: | repressor |
Biological process: | Zinc homeostasis |
Effector: | Zinc ion, (Zn2+) |
Phylum: | Cyanobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Nostoc sp. PCC 7120 | ||||
Position: -122
Score: 5.8542 Sequence: GTGATAATAATAATCATTATCTA
Locus tag: alr4028
Name: omp Funciton: Zinc-regulated TonB-dependent outer mambrane receptor
Locus tag: alr4029
Name: omp Funciton: Zinc-regulated TonB-dependent outer mambrane receptor
Locus tag: alr4030
Name: alr4030 Funciton: Putative ferredoxin, COG3411 family
Locus tag: alr4031
Name: alr4031 Funciton: ABC transporter, periplasmic binding protein, COG0614 family
Locus tag: alr4032
Name: alr4032 Funciton: ABC transporter, permease protein
Locus tag: alr4033
Name: alr4033 Funciton: ABC transporter, ATP-binding protein |
||||
omp-omp-alr4030-alr4031-alr4032-alr4033 | -122 | 5.9 | GTGATAATAATAATCATTATCTA | alr4028 |