Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing alr4031 gene

Properties
Regulog: Zur - Cyanobacteria
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Cyanobacteria
Built upon 84 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Nostoc sp. PCC 7120
Position: -122
Score: 5.8542
Sequence: GTGATAATAATAATCATTATCTA
Locus tag: alr4028
Name: omp
Funciton: Zinc-regulated TonB-dependent outer mambrane receptor
Locus tag: alr4029
Name: omp
Funciton: Zinc-regulated TonB-dependent outer mambrane receptor
Locus tag: alr4030
Name: alr4030
Funciton: Putative ferredoxin, COG3411 family
Locus tag: alr4031
Name: alr4031
Funciton: ABC transporter, periplasmic binding protein, COG0614 family
Locus tag: alr4032
Name: alr4032
Funciton: ABC transporter, permease protein
Locus tag: alr4033
Name: alr4033
Funciton: ABC transporter, ATP-binding protein
omp-omp-alr4030-alr4031-alr4032-alr4033 -122 5.9 GTGATAATAATAATCATTATCTA alr4028
© 2009-2020 RegPrecise