Orthologous regulated operons containing BACSTE_02669 gene
| Regulog: | PerR - Bacteroidaceae |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Peroxide stress response; Oxidative stress response |
| Effector: | Hydrogen peroxide |
| Phylum: | Bacteroidetes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacteroides stercoris ATCC 43183 | ||||
|
Position: -29
Score: 6.20282 Sequence: ATATTTGTAATGATTATAATTTG
Locus tag: BACSTE_00833
Name: BT1211 Funciton: hypothetical protein
Locus tag: BACSTE_00832
Name: null Funciton: hypothetical protein
Locus tag: BACSTE_00831
Name: cydA Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
Locus tag: BACSTE_00830
Name: cydB Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-) |
||||
| BT1211-BACSTE_00832-cydA-cydB | -29 | 6.2 | ATATTTGTAATGATTATAATTTG | BACSTE_00833 |