Orthologous regulated operons containing BACSTE_02669 gene

Properties
Regulog:	PerR - Bacteroidaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Peroxide stress response; Oxidative stress response
Effector:	Hydrogen peroxide
Phylum:	Bacteroidetes

Built upon 51 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bacteroides stercoris ATCC 43183
Position: -29 Score: 6.20282 Sequence: ATATTTGTAATGATTATAATTTG Locus tag: BACSTE_00833 Name: BT1211 Funciton: hypothetical protein Locus tag: BACSTE_00832 Name: null Funciton: hypothetical protein Locus tag: BACSTE_00831 Name: cydA Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) Locus tag: BACSTE_00830 Name: cydB Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
BT1211-BACSTE_00832-cydA-cydB	-29	6.2	ATATTTGTAATGATTATAATTTG	BACSTE_00833

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --