Orthologous regulated operons containing PS51257 gene

Properties
Regulog:	ManR - Bacteroidaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Mannose utilization; Mannosides utilization
Effector:	Mannose
Phylum:	Bacteroidetes

Built upon 9 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bacteroides eggerthii DSM 20697
Position: -4 Score: 5.60611 Sequence: TATTATGTATGAACATGATA Locus tag: BACEGG_01986 Name: manK Funciton: predicted mannose kinase, ROK family Locus tag: BACEGG_01987 Name: null Funciton: hypothetical protein Locus tag: BACEGG_01988 Name: susC_Man-1 Funciton: TonB-dependent outer membrane transporter of mannan oligomers Locus tag: BACEGG_01989 Name: susD_Man-1 Funciton: Outer membrane polysaccharide binding protein for mannan oligomers Locus tag: BACEGG_01990 Name: PS51257 Funciton: PROKAR_LIPOPROTEIN Locus tag: BACEGG_01991 Name: manA Funciton: putative alpha-1,2-mannosidase Locus tag: BACEGG_01992 Name: null Funciton: hypothetical protein Locus tag: BACEGG_01993 Name: manP Funciton: Predicted mannose transporter, FucP family
manK-BACEGG_01987-susC_Man-1-susD_Man-1-PS51257-manA-BACEGG_01992-manP	-4	5.6	TATTATGTATGAACATGATA	BACEGG_01986
Bacteroides ovatus ATCC 8483
Position: -4 Score: 5.13496 Sequence: AACTATGTATGAACATGATG Locus tag: BACOVA_03252 Name: manK Funciton: predicted mannose kinase, ROK family Locus tag: BACOVA_03253 Name: susC_Man-1 Funciton: TonB-dependent outer membrane transporter of mannan oligomers Locus tag: BACOVA_03254 Name: susD_Man-1 Funciton: Outer membrane polysaccharide binding protein for mannan oligomers Locus tag: BACOVA_03255 Name: PS51257 Funciton: PROKAR_LIPOPROTEIN Locus tag: BACOVA_03256 Name: PF03663 Funciton: Glycoside hydrolase, family 76 Locus tag: BACOVA_03257 Name: PF03663 Funciton: Glycoside hydrolase, family 76 Locus tag: BACOVA_03258 Name: manA Funciton: putative alpha-1,2-mannosidase Locus tag: BACOVA_03259 Name: manP Funciton: Predicted mannose transporter, FucP family
manK-susC_Man-1-susD_Man-1-PS51257-PF03663-PF03663-manA-manP	-4	5.1	AACTATGTATGAACATGATG	BACOVA_03252