Orthologous regulated operons containing BT2109 gene

Properties
Regulog:	ManR - Bacteroidaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Mannose utilization; Mannosides utilization
Effector:	Mannose
Phylum:	Bacteroidetes

Built upon 9 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bacteroides thetaiotaomicron VPI-5482
Position: -148 Score: 5.86143 Sequence: CAATATGTATATACATATAG Locus tag: BT2107 Name: susC_Man-1 Funciton: TonB-dependent outer membrane transporter of mannan oligomers Locus tag: BT2108 Name: susD_Man-1 Funciton: Outer membrane polysaccharide binding protein for mannan oligomers Locus tag: BT2109 Name: null Funciton: Galactose-binding domain-like Locus tag: BT2110 Name: null Funciton: hypothetical protein Locus tag: BT2111 Name: manA Funciton: putative alpha-1,2-mannosidase Locus tag: BT2112 Name: GH43 Funciton: Glycosyl hydrolases family 43 Locus tag: BT2113 Name: GH38 Funciton: Glycosyl hydrolases family 38, putative Alpha-mannosidase
susC_Man-1-susD_Man-1-BT2109-BT2110-manA-GH43-GH38	-148	5.9	CAATATGTATATACATATAG	BT2107

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --