Orthologous regulated operons containing susD_Man-1 gene
| Regulog: | ManR - Bacteroidaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Mannose utilization; Mannosides utilization |
| Effector: | Mannose |
| Phylum: | Bacteroidetes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacteroides eggerthii DSM 20697 | ||||
|
Position: -4
Score: 5.60611 Sequence: TATTATGTATGAACATGATA
Locus tag: BACEGG_01986
Name: manK Funciton: predicted mannose kinase, ROK family
Locus tag: BACEGG_01987
Name: null Funciton: hypothetical protein
Locus tag: BACEGG_01988
Name: susC_Man-1 Funciton: TonB-dependent outer membrane transporter of mannan oligomers
Locus tag: BACEGG_01989
Name: susD_Man-1 Funciton: Outer membrane polysaccharide binding protein for mannan oligomers
Locus tag: BACEGG_01990
Name: PS51257 Funciton: PROKAR_LIPOPROTEIN
Locus tag: BACEGG_01991
Name: manA Funciton: putative alpha-1,2-mannosidase
Locus tag: BACEGG_01992
Name: null Funciton: hypothetical protein
Locus tag: BACEGG_01993
Name: manP Funciton: Predicted mannose transporter, FucP family |
||||
| manK-BACEGG_01987-susC_Man-1-susD_Man-1-PS51257-manA-BACEGG_01992-manP | -4 | 5.6 | TATTATGTATGAACATGATA | BACEGG_01986 |
| Bacteroides ovatus ATCC 8483 | ||||
|
Position: -4
Score: 5.13496 Sequence: AACTATGTATGAACATGATG
Locus tag: BACOVA_03252
Name: manK Funciton: predicted mannose kinase, ROK family
Locus tag: BACOVA_03253
Name: susC_Man-1 Funciton: TonB-dependent outer membrane transporter of mannan oligomers
Locus tag: BACOVA_03254
Name: susD_Man-1 Funciton: Outer membrane polysaccharide binding protein for mannan oligomers
Locus tag: BACOVA_03255
Name: PS51257 Funciton: PROKAR_LIPOPROTEIN
Locus tag: BACOVA_03256
Name: PF03663 Funciton: Glycoside hydrolase, family 76
Locus tag: BACOVA_03257
Name: PF03663 Funciton: Glycoside hydrolase, family 76
Locus tag: BACOVA_03258
Name: manA Funciton: putative alpha-1,2-mannosidase
Locus tag: BACOVA_03259
Name: manP Funciton: Predicted mannose transporter, FucP family |
||||
| manK-susC_Man-1-susD_Man-1-PS51257-PF03663-PF03663-manA-manP | -4 | 5.1 | AACTATGTATGAACATGATG | BACOVA_03252 |
| Bacteroides thetaiotaomicron VPI-5482 | ||||
|
Position: -148
Score: 5.86143 Sequence: CAATATGTATATACATATAG
Locus tag: BT2107
Name: susC_Man-1 Funciton: TonB-dependent outer membrane transporter of mannan oligomers
Locus tag: BT2108
Name: susD_Man-1 Funciton: Outer membrane polysaccharide binding protein for mannan oligomers
Locus tag: BT2109
Name: null Funciton: Galactose-binding domain-like
Locus tag: BT2110
Name: null Funciton: hypothetical protein
Locus tag: BT2111
Name: manA Funciton: putative alpha-1,2-mannosidase
Locus tag: BT2112
Name: GH43 Funciton: Glycosyl hydrolases family 43
Locus tag: BT2113
Name: GH38 Funciton: Glycosyl hydrolases family 38, putative Alpha-mannosidase |
||||
| susC_Man-1-susD_Man-1-BT2109-BT2110-manA-GH43-GH38 | -148 | 5.9 | CAATATGTATATACATATAG | BT2107 |