Orthologous regulated operons containing BT2113 gene
| Regulog: | ManR - Bacteroidaceae |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Mannose utilization; Mannosides utilization |
| Effector: | Mannose |
| Phylum: | Bacteroidetes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacteroides thetaiotaomicron VPI-5482 | ||||
|
Position: -148
Score: 5.86143 Sequence: CAATATGTATATACATATAG
Locus tag: BT2107
Name: susC_Man-1 Funciton: TonB-dependent outer membrane transporter of mannan oligomers
Locus tag: BT2108
Name: susD_Man-1 Funciton: Outer membrane polysaccharide binding protein for mannan oligomers
Locus tag: BT2109
Name: null Funciton: Galactose-binding domain-like
Locus tag: BT2110
Name: null Funciton: hypothetical protein
Locus tag: BT2111
Name: manA Funciton: putative alpha-1,2-mannosidase
Locus tag: BT2112
Name: GH43 Funciton: Glycosyl hydrolases family 43
Locus tag: BT2113
Name: GH38 Funciton: Glycosyl hydrolases family 38, putative Alpha-mannosidase |
||||
| susC_Man-1-susD_Man-1-BT2109-BT2110-manA-GH43-GH38 | -148 | 5.9 | CAATATGTATATACATATAG | BT2107 |