Orthologous regulated operons containing manA gene

Properties
Regulog:	ManR - Bacteroidaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Mannose utilization; Mannosides utilization
Effector:	Mannose
Phylum:	Bacteroidetes

Built upon 9 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bacteroides thetaiotaomicron VPI-5482
Position: -41 Score: 5.83282 Sequence: TTATATGTTCAGACATACTA Locus tag: BT2104 Name: pmi-manK Funciton: Mannose-6-phosphate isomerase (EC 5.3.1.8) / predicted mannose kinase, ROK family Locus tag: BT2105 Name: manA Funciton: putative alpha-1,2-mannosidase Locus tag: BT2106 Name: manP Funciton: Predicted mannose transporter, FucP family
pmi-manK-manA-manP	-41	5.8	TTATATGTTCAGACATACTA	BT2104

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --